The single-use device market is primed for growth. Single-use systems (SUS) are now used for about 85 percent of precommercial scale (preclinical and clinical) biopharmaceutical manufacturing and increasingly for commercial products manufacturing. This shift from fixed stainless steel appears to be revolutionizing the therapeutics market.

While large-scale, fixed stainless-steel equipment-based bioprocessing facilities continue producing biopharmaceuticals, the market for SUS, composed primarily of plastic components that are sealed and sterilized using gamma irradiation, continues its rapid ascent. Medical device makers are seeing growth in single-use instruments and disposable medical devices, including process containers, tubing, connectors, baskets, and valves. According to Grand View Research, in 2019, the global SUS market was valued at $12.6 billion, with a 12.8 percent compound annual growth rate forecast through 2027, when it will top $33 billion.

Lower energy and direct-labor costs plus faster changeover times are important reasons why. Like any major change, the SUS shift brings with it challenges as pharmaceutical manufacturers and medical device makers turn to their suppliers to provide assurance that their products deploy operational best practices and are certifiably safe.

To address key challenges in the SUS market and meet the product development needs of Tier 1 pharmaceutical and medical device companies, collaboration is seen between Tier 2 system suppliers and Tier 3 components suppliers.

One such effort comes in the form of the BioPhorum Operations Group, a global collaboration comprising more than 90 Tier 1, 2 and 3 biopharmaceutical companies and suppliers; its purpose is to develop and share best practices for pharmaceutical and medical device manufacturing. For example, BioPhorum has succeeded in establishing effective testing methods for extractables and leachables to help the industry approve SUS for safe and effective use.

To select processing materials that avoid risk, its important to understand the chemical nature of extractables, which are compounds emitted from a packaging component, delivery system, or manufacturing surface during aggressive testing; and leachables, which are compounds that migrate into the drug over time from contact with the system componentry and manufacturing surfaces.

To assist suppliers with their evaluation of SUS extractables, the BioPhorum team developed testing protocols based on a set of solvents and immersion times. Adhering to such protocols helps ensure the successful use of SUS for biopharmaceutical manufacturing, though the final responsibility for confirming the safety and efficacy of the therapeutic remains that of the Tier 1 pharmaceutical companies and medical device makers, not their suppliers.

Complementing the BioPhorum extractables protocol is a best practice guide for evaluating SUS leachables. BioPhorum protocol applies to SUS components that contact the pharmaceutical product or process fluids, including but not limited to the medical device/drug delivery market:

Note: The standardized extractables testing protocol does not cover final container closure systems.

Achieving medical-grade system components requires treating the part as a medical product when it comes to cleanroom and manufacturing practices. For tubing, for example, its no longer acceptable to manufacture medical-device-grade tubing on the production floor and then attempt to sterilize it. Tubing production for any medical device must take place in ISO certified cleanrooms that adhere to FDA's Current Good Manufacturing Practices governing particulates, air pressure, and personnel practices to ensure that products meet tolerance and cleanliness requirements. This may require bioburden and endotoxin testing.

These procedures help ensure production of safe, validated products in critical areas such as the transfer of monoclonal antibodies, laboratory-produced base media for therapeutics engineered to represent the bodys immunes system and used in the development of cancer-treating therapeutics. The tubing must be bacteria-free and remain strong as it transfers the monoclonal antibodies to the bioreactor and chromatography equipment, where wanted therapeutics are filtered out.

Other single-use tubing applications include peristaltic pumps with rotating wheels that push the fluid through tubes. To withstand the rigors of the pumping process and ensure that the tubing walls remain intact, high-strength tubing is required.

Advancements in therapeutics will continue driving the development and growth of SUS and their components. One such advancementchimeric antigen receptor (CAR T) cell therapy under development by Kite, a Gilead Companytaps into the potential of personalized medicine for cancer treatments, using the patients immune system to target and attack tumors.

T-cells, a white blood cell developed from stem cells in the bone marrow, help the body to fight cancer and infections. Currently, three FDA-approved CAR T cell therapies, developed by Gilead and Novartis, are available. There is also exponential growth of other biotechnology and pharmaceutical companies actively advancing cellular immunotherapies through clinical trials.

Investigational for now, the safety and efficacy of T-cell therapy is an active area of research, and it could prove to be a game-changer. A cancer patients blood is collected and purified to select the T-cells, which are activated and expanded within the lab and transfected to express a chimeric antigen receptor, or synthetic T-cell receptor, targeting a specific tumor antigen. The T-cells grow and expand for two weeks and are then infused back into the patient where the engineered cells attack the tumors. This chain of events requires a precise timeline with all components of the process being sterile and having passed stringent testing for quality and reliability.

Unlocking the immune system to effectively fight cancer is truly exciting and serves as a great illustration of the potential medical device use of SUS in biopharmaceutical processing.

Continue reading here:
Onward and Upward for Single-Use Systems in Bioprocessing - Medical Device and Diagnostics Industry

Bone Marrow Stem Cells Comments Off on Onward and Upward for Single-Use Systems in Bioprocessing – Medical Device and Diagnostics Industry | January 27th, 2021

Express News Service

KOCHI:How would a two-year-old child react when she meets her lifes saviour in real life? It is quite hard to imagine. Or from the other side, the reaction of the person who sees, after two years, the face of the infant he rescued from certain death.

At times, emotions just abound, beyond what words can express! Tears of joy rolled down Amir's face, when he first met two-year-old Vihaa Khanekar, to whom he had donated his blood stem cells in 2019, on Saturday.

The four-hour-long video call that Amir made to Vihaa and her family members late on Saturday made him make up his mind to fly to Pune soon to meet Vihaa. A Pune resident, Vihaa was diagnosed with Juvenile Myelomonocytic Leukemia (JML), when she was barely four-and-a-half months' old. Bone marrow transplant was the only hope and her parents were devastated.

"When we first heard the news it was as if we were hit by a hailstorm. It was known that our daughters condition was a rare one and that it was difficult for her to get a transplant. Her father swooned and even her mother almost had a blackout. The whole family came together to support them," said Dnyaneshwar Khanekar, Vihaas grandfather.

Vihaa received the cells in September 2019. "She was diagnosed with the illness in March. It is Amir who saved her life. In 2018, Amir had registered with the DATRI-Blood Stem Donors Registry in Aluva. His blood stem cells were a match and Amir was happy to donate them,"said Aby Sam John, DATRI Kerala- Maharastra Regional head.

26-year-old Amir Suhail Hussain, a resident of Nedumbassery, is not only happy about saving a life, but he also urged like-minded people to come forward. "When I came to know about Vihaa, I had no hesitation. However, my kin, particularly my parents, were anxious, more so because they were ignorant about the whole process. After assurances from doctors, they came to terms with my decision," said Amir.

According to Vihaas parents, her condition is better, with no complications. The transplant took place at a private hospital in Pune. "Though Amir is not known to us, his generosity has overwhelmed us," said Sandeep Khanekar, Vihaa's father.

The Saviour and Survivor meet was held by DATRI as part of creating awareness among many about donating stem cells and saving lives. The meet was organised virtually. DATRI - Indias largest blood stem cell donor registry - has 4,61,627 donors registered. A total of 773 people have donated their blood stem cells.

Read this article:
From Kochi, with love - Stem cell donor meets infant survivor after two years - The New Indian Express

Bone Marrow Stem Cells Comments Off on From Kochi, with love – Stem cell donor meets infant survivor after two years – The New Indian Express | January 25th, 2021

Life for Miro, a 5-year-old German shepherd, has been what his owner describes as an emotional roller coaster over the past two years. Several peaks and valleys have dotted his metaphorical landscape as he has gone from premiere fitness to dealing with injuries and disease. But a clinical trial at the UC Davis veterinary hospital may have put him back on a positive track.

Working as a patrol dog with his handler/owner Martin Gilbertson, a ranger with California State Parks, Miro spent three years performing duties that required him to be at the top of his game. In early 2019, he was just that, having won the top dog award for his department.

By that summer, however, things started declining for Miro. He was diagnosed with lumbosacral intervertebral disc disease that caused spinal cord compression. UC Davis veterinary neurosurgeons performed a surgical decompression, and Miro eventually recovered after a lengthy recuperation period.

Miro with his handler Martin Gilbertson

Life was great, said Gilbertson. By early December 2019, Miro was cleared to return to work. I thought all the troubles were behind us.

Sign up for our newsletter and stay in the know.

It only took a few weeks, though, until the roller coaster cleared a peak and started to descend.

In late December 2019, Miro collapsed for no apparent reason and started shaking in a way Gilbertson had never seen. So, the pair returned to UC Davis where Miro was diagnosed with myasthenia gravis, a disease in which there is a malfunction in the transmission of signals between the nerves and muscles. This causes muscle weakness, and an inability to walk or run properly, as well as potentially devastating neuromuscular disorders.

Gilbertson was devastated.

To go from the pinnacle of our profession to potentially being a couch potato at best for the rest of his life was a real gut check, he said.

But hope appeared a few weeks later when Neurology/Neurosurgery Service faculty members Drs. Pete Dickinson and Bev Sturges informed Gilbertson of a myasthenia gravis clinical trial they were beginning with the help of the schools Center for Companion Animal Health (CCAH) and the Veterinary Institute for Regenerative Cures.

I thought, What do we have to lose? stated Gilbertson. Dr. Dickinson told me that Miro would be the first dog to ever receive this new treatment. We were excited and grateful to be able to participate.

A computer program shows Miro's stride pattern on the Tekscan Strideway pressure walkway.

Over the next few months, Miro received three stem cell treatments, as well as traditional medications to treat myasthenia gravis. Additionally, part of Miros recovery involved examining his gait, which utilized a new piece of equipment aimed at better analyzing a dogs stride pattern. Thanks to CCAH funding, the school recently acquired a Tekscan Strideway pressure walkway that allows clinicians and researchers to better gauge a patients step pattern and make decisions about their optimal care and recovery. To fully understand a patients gait abnormalities associated with injuries or neuromuscular diseases, veterinarians and researchers rely on objective, quantitative ways to assess locomotor function. The Strideway system complements the force plates in the schools J.D. Wheat Veterinary Orthopedic Research Laboratory, which captures extensive information, but only for one gait step. The new pressure walkway expands the capabilities to quantify pressure, vertical force, and stride parameters (timing and spacing) on all limbs for several strides during walking, trotting or landing. Miros progress was able to be tracked with pinpoint accuracy throughout his recovery.

Before the trial, Miro could only walk about 10 steps before falling down. After the trial, he seemed fully recovered, and blood tests revealed no trace of antibodies to the disease. While the disease may not be completely gone from his system, the clinical trial seems to have repressed the disease to a point where it no longer inhibits Miro from his normal activities. Retired from his job, Miro now enjoys life as a family pet.

It is true that Miro is now in remission, but until more analysis of data is completed, it is still too early to determine if the stem cells were the driving force behind his recovery, since they were administered at the same time as standard-of-care medications. Miros results are being closely examined, along with the results of two other dogs that have completed the trial, to see if this stem cells treatment truly can be considered a cure for myasthenia gravis. Regardless of the final outcome of the study, Miros recovery, in one way or another, came from a novel combination of treatments pioneered at UC Davis.

Originally posted here:
Novel Treatment Leads to Dog's Recovery - The Bark

Spinal Cord Stem Cells Comments Off on Novel Treatment Leads to Dog’s Recovery – The Bark | January 25th, 2021

Researchers at the National Institutes of Health have discovered a new genetic disorder characterized by developmental delays and malformations of the brain, heart and facial features. Named linkage-specific-deubiquitylation-deficiency-induced embryonic defects syndrome (LINKED), it is caused by a mutated version of the OTUD5 gene, which interferes with key molecular actions in embryo development.

The findings indicate that the newly identified pathway may be essential for human growth and may also underlie other disorders that are present at birth. The information will help scientists better understand such diseasesboth common and rareand enhance patient care. The results were reported Jan. 20, 2021 at Science Advances.

The project began when David B. Beck, M.D., Ph.D., a clinical fellow in the laboratory of Dan Kastner M.D., Ph.D., at the National Human Genome Research Institute (NHGRI) and co-first author, was asked to consult on a male baby who had been born with severe birth defects that included abnormalities of the brain, craniofacial skeleton, heart and urinary tract.

Our discovery of the dysregulated neurodevelopmental pathway that underlies LINKED syndrome was only possible through the teamwork of geneticists, developmental biologists and biochemists from NIH,. This collaboration provided the opportunity to pinpoint the likely genetic cause of disease, and then take it a step further to precisely define the sequence of cellular events that are disrupted to cause the disease.

Achim Werner, Ph.D., Investigator, National Institute of Dental and Craniofacial Research (NIDCR) and Lead Author

An in-depth examination of siblings and family members genomes, combined with hereditary bioinformatics analyses, revealed a mutation in the OTUD5 gene as the possible cause of the problem. Through outreach to other researchers working on similar problems, Beck found seven additional males ranging from 1 to 14 years of age who shared symptoms with the first patient and had varying mutations in the OTUD5 gene.

The gene comprises instructions for making the OTUD5 enzyme, which is involved in ubiquitylation, a process which molecularly alters a protein to change its purpose. Ubiquitylation plays a part in governing cell fate, where stem cells are taught to turn into specific cell types in the early stages of embryo development.

According to the genetic evidence, I was pretty sure OTUD5 mutations caused the disease, but I did not understand how this enzyme, when mutated, led to the symptoms seen in our patients, said Beck. For this reason we sought to work with Dr. Werners group, which specializes in using biochemistry to comprehend the functions of enzymes such as OTUD5.

To begin, the NIH team analyzed cells taken from patient samples, which were processed in the NIH Clinical Center. Usually, OTUD5 edits or eliminates molecular tags on particular proteins (substrates) to modulate their function. However, in cells from patients with OTUD5 mutations, this activity was diminished.

Using a method to reunite mature human cells into the stem cell-like state of embryo cells, the scientists discovered that OTUD5 mutations were linked to abnormalities in the development of neural crest cells, which give rise to tissues of the craniofacial skeleton, and of neural precursors, cells that eventually give rise to the brain and spinal cord.

In additional experiments, the team discovered that the OTUD5 enzyme acts on a few protein substrates called chromatin remodelers. This class of proteins alters the closely packed strands of DNA in a cells nucleus to make sure genes accessible for being turned on, or expressed.

With help from collaborators led by Pedro Rocha Ph.D., an investigator in the National Institute of Child Health and Human Development (NICHD), the group found that chromatin remodelers targeted by OTUD5 help enhance expression of genes that control the cell fate of neural precursors during embryo development.

Taken together, the investigators reasoned, OTUD5 normally keeps these chromatin remodelers from being tagged for destruction. However, while OTUD5 is mutated, its protective function is lost and the chromatin remodelers are destroyed, leading to abnormal development of neural precursors and neural crest cells. Ultimately, these changes can lead to some of the birth defects seen in LINKED patients.

This implies that the mechanism we discovered is a portion of a common developmental pathway that, when mutated at different points, will result in a spectrum of disease.

We were amazed to discover that OTUD5 elicits its effects via multiple, functionally related substrates, which shows a new principle of cellular signaling during early embryonic development, said Mohammed A. Basar, Ph.D., a postdoctoral fellow in Werners lab and co-first author of this study. These findings lead us to believe that OTUD5 may have far-reaching effects beyond those identified in LINKED patients.

In future work, Werners team plans to fully investigate the role which OTUD5 and similar enzymes play in development. The researchers hope the study can serve as a guiding framework for unraveling the causes of other undiagnosed diseases, ultimately helping clinicians better evaluate and care for patients.

Were finally able to provide families with a diagnosis, bringing an end to what is often a long and exhausting search for answers, said Beck.

Source:

Journal reference:

Beck, D.B.,et al.(2021) Linkage-specific deubiquitylation by OTUD5 defines an embryonic pathway intolerant to genomic variation.Science Advances.doi.org/10.1126/sciadv.abe2116.

Read more:
Scientists find uncommon hereditary disorder that influences the brain, heart and facial highlights - Microbioz India

Spinal Cord Stem Cells Comments Off on Scientists find uncommon hereditary disorder that influences the brain, heart and facial highlights – Microbioz India | January 25th, 2021

Stem Cell Therapy Market: Snapshot

Of late, there has been an increasing awareness regarding the therapeutic potential of stem cells for management of diseases which is boosting the growth of the stem cell therapy market. The development of advanced genome based cell analysis techniques, identification of new stem cell lines, increasing investments in research and development as well as infrastructure development for the processing and banking of stem cell are encouraging the growth of the global stem cell therapy market.

Get Brochure of the Report @ https://www.tmrresearch.com/sample/sample?flag=B&rep_id=1787

One of the key factors boosting the growth of this market is the limitations of traditional organ transplantation such as the risk of infection, rejection, and immunosuppression risk. Another drawback of conventional organ transplantation is that doctors have to depend on organ donors completely. All these issues can be eliminated, by the application of stem cell therapy. Another factor which is helping the growth in this market is the growing pipeline and development of drugs for emerging applications. Increased research studies aiming to widen the scope of stem cell will also fuel the growth of the market. Scientists are constantly engaged in trying to find out novel methods for creating human stem cells in response to the growing demand for stem cell production to be used for disease management.

It is estimated that the dermatology application will contribute significantly the growth of the global stem cell therapy market. This is because stem cell therapy can help decrease the after effects of general treatments for burns such as infections, scars, and adhesion. The increasing number of patients suffering from diabetes and growing cases of trauma surgery will fuel the adoption of stem cell therapy in the dermatology segment.

Global Stem Cell Therapy Market: Overview

Also called regenerative medicine, stem cell therapy encourages the reparative response of damaged, diseased, or dysfunctional tissue via the use of stem cells and their derivatives. Replacing the practice of organ transplantations, stem cell therapies have eliminated the dependence on availability of donors. Bone marrow transplant is perhaps the most commonly employed stem cell therapy.

Osteoarthritis, cerebral palsy, heart failure, multiple sclerosis and even hearing loss could be treated using stem cell therapies. Doctors have successfully performed stem cell transplants that significantly aid patients fight cancers such as leukemia and other blood-related diseases.

Global Stem Cell Therapy Market: Key Trends

The key factors influencing the growth of the global stem cell therapy market are increasing funds in the development of new stem lines, the advent of advanced genomic procedures used in stem cell analysis, and greater emphasis on human embryonic stem cells. As the traditional organ transplantations are associated with limitations such as infection, rejection, and immunosuppression along with high reliance on organ donors, the demand for stem cell therapy is likely to soar. The growing deployment of stem cells in the treatment of wounds and damaged skin, scarring, and grafts is another prominent catalyst of the market.

On the contrary, inadequate infrastructural facilities coupled with ethical issues related to embryonic stem cells might impede the growth of the market. However, the ongoing research for the manipulation of stem cells from cord blood cells, bone marrow, and skin for the treatment of ailments including cardiovascular and diabetes will open up new doors for the advancement of the market.

To get Incredible Discounts on this Report, Click Here @ https://www.tmrresearch.com/sample/sample?flag=D&rep_id=1787

Global Stem Cell Therapy Market: Market Potential

A number of new studies, research projects, and development of novel therapies have come forth in the global market for stem cell therapy. Several of these treatments are in the pipeline, while many others have received approvals by regulatory bodies.

In March 2017, Belgian biotech company TiGenix announced that its cardiac stem cell therapy, AlloCSC-01 has successfully reached its phase I/II with positive results. Subsequently, it has been approved by the U.S. FDA. If this therapy is well- received by the market, nearly 1.9 million AMI patients could be treated through this stem cell therapy.

Another significant development is the granting of a patent to Israel-based Kadimastem Ltd. for its novel stem-cell based technology to be used in the treatment of multiple sclerosis (MS) and other similar conditions of the nervous system. The companys technology used for producing supporting cells in the central nervous system, taken from human stem cells such as myelin-producing cells is also covered in the patent.

Global Stem Cell Therapy Market: Regional Outlook

The global market for stem cell therapy can be segmented into Asia Pacific, North America, Latin America, Europe, and the Middle East and Africa. North America emerged as the leading regional market, triggered by the rising incidence of chronic health conditions and government support. Europe also displays significant growth potential, as the benefits of this therapy are increasingly acknowledged.

Asia Pacific is slated for maximum growth, thanks to the massive patient pool, bulk of investments in stem cell therapy projects, and the increasing recognition of growth opportunities in countries such as China, Japan, and India by the leading market players.

Global Stem Cell Therapy Market: Competitive Analysis

Several firms are adopting strategies such as mergers and acquisitions, collaborations, and partnerships, apart from product development with a view to attain a strong foothold in the global market for stem cell therapy.

Some of the major companies operating in the global market for stem cell therapy are RTI Surgical, Inc., MEDIPOST Co., Ltd., Osiris Therapeutics, Inc., NuVasive, Inc., Pharmicell Co., Ltd., Anterogen Co., Ltd., JCR Pharmaceuticals Co., Ltd., and Holostem Terapie Avanzate S.r.l.

Request For TOC @ https://www.tmrresearch.com/sample/sample?flag=T&rep_id=1787

About TMR Research:

TMR Research is a premier provider of customized market research and consulting services to business entities keen on succeeding in todays supercharged economic climate. Armed with an experienced, dedicated, and dynamic team of analysts, we are redefining the way our clients conduct business by providing them with authoritative and trusted research studies in tune with the latest methodologies and market trends.

Contact:

TMR Research,3739 Balboa St # 1097,San Francisco, CA 94121United States

Tel: +1-415-520-1050

https://neighborwebsj.com/

Here is the original post:
Stem Cell Therapy Market to Witness Increase in Revenues by 2025 NeighborWebSJ - NeighborWebSJ

Skin Stem Cells Comments Off on Stem Cell Therapy Market to Witness Increase in Revenues by 2025 NeighborWebSJ – NeighborWebSJ | January 25th, 2021

Body Shop stans, assemble! We have collated the best the brand has to offer to optimise your bathroom cabinet.

But before you start shopping, here are a few did you knows. This cruelty-free, British brand was the first international cosmetics brand to prohibit the use of ingredients tested on animals and one of the first to promote Fair Trade with third world countries. Earning its place as a household name over the past four decades plus a cult following, thanks to a diverse range of over 900 products, suitable for different skin tones and types and half of which are vegan.

For some insight, this Brighton-born beauty story dates back to 1976. It was founded by the iconic entrepreneur and human rights activist Dame Anita Roddick, pioneer to ethical consumerism, who wanted to create a high quality, revolutionary skincare range that would be a positive force in the beauty landscape. What differentiated Roddicks vision to other beauty giants was her desire to create the perfect harmony between quality, accessibility, environmental consciousness (starting out with refillable containers etc) and profit. That passion filtered through to employees - and the brand's ideology hasnt much changed along the years.

Helping disadvantaged communities is a brand priority and they have been sourcing their Community Fair Trade (CFT) shea butter from Tungteiya Womens Association in Northern Ghana since 1994. Where 640 women from 11 villages, handcraft shea butter using an 18-stage process of traditional techniques, successfully creating generational opportunities passed from mother to daughter. Their CFT handcrafted paper and gift packaging is also sustainably sourced from Kathmandu, Nepal.

A B Corp certified brand is amongst the 3,000 businesses worldwide to have the highest social and environmental standards for people and the planet. One focus is on using plant-based and recycled plastic (rather than oil-based plastics) and creating initiatives to aid consumers around the world to reuse, repurpose and recycle. In 2019, we reintroduced our pioneering refill scheme, a recycling programme and removed 21 tonnes of plastic from our gifts. says says Linda Campbell, Managing Director for the UK.

The ideals of The Body Shops founder had a direct impact on the direction of the brand. They havent shied away from supporting feminist movements, constantly raising the bar on ethical consciousness and fighting to empower girls and women across all demographics. The Body Shop have spent the last few years initiating and aligning with campaigns, most recently the Covid-19 response derived #IsolatedNotAlone campaign. With the objective of raising awareness on domestic abuse and providing potentially life-saving resources for survivors and bystanders at increased risk during lockdown measures." says Campbell.

If all this doesnt make you feel more passionate about the brand, we dont know what will. And that's before we even get the quality products at consumer friendly prices. But dont let the Body Shop name fool you though, as not only extensive bath and body sup, but skincare, haircare and vegan makeup.

If youre a lover of newness, you might want to investigate the latest drop, which includes Hemp Dry Body Oil, 14, and the Drops of Youth Bouncy Jelly Mist, 16. A gel-to-mist formula protect the skin from indoor and outdoor pollution as well as the effects of blue light from all the Zooming.

But the beauty giant is just as loved for its cult products, from the nourishing glow masks to their world famous body butters (which sell at a rate of one every three seconds). If you want to know what the hype is really about, here is a selection of the 10 bestselling products and why they deserve a spot in your bathroom cabinet.

Read more:
Here's Why The Body Shop Is A Cult Brand to Know Plus The Best-Sellers To Buy - GLAMOUR UK

Skin Stem Cells Comments Off on Here’s Why The Body Shop Is A Cult Brand to Know Plus The Best-Sellers To Buy – GLAMOUR UK | January 23rd, 2021

While the thought of dozens of tiny needles aimed directly at our faces sounds like a scare, microneedling may be worth it for the radiant skin it delivers. As with any trending procedure, it has its pros and consheres what four top doctors want you to know before scheduling an appointment.

It Opens Up the Skin BarrierMicroneedling creates little puncture sites in the skin, which allow for deeper product penetration, says Highland Park, IL plastic surgeon Steven P. Bloch, MD, who recommends combining the treatment with TCA peels that include hydrogen peroxide, exosomesthe healing, skin-calming growth factors derived from stem cellsor vitamins to stimulate collagen and elastin production. Applying medical-grade skin-care products after the procedure offers the best results because the skin will soak everything up much more effectively.

It Stimulates Collagen ProductionAs we age, our bodies produce less collagen (starting as early as our 20s), and therefore our skin begins to lose elasticity. However, Birmingham, AL dermatologist Corey Hartman, MD explains that microneedling promotes collagen production in our skin cells, helping it look as young as possible. Microneedling, which works on all skin types, administers small injuries to kick the bodys natural healing process into gear and rejuvenate the skin, he explains. Though there are only a few procedures in cosmetic dermatology that are truly preventive, microneedling delivers on the promise to stimulate fibroblasts, which synthesize the production of collagen.

ItCanBeEffectiveforTreatingMelasmaOne of the most common concerns women walk into our office with is melasma, says Grand Rapids, MI plastic surgeon Bradley Bengtson, MD. More often than not, melasma is not optimally treated with high-heat laser devices, so microneedling is a great tool to break up the pigment. The procedure banishes dark patches by allowing brightening creams and serums with ingredients like vitamin C to penetrate deep into the epidermal and dermal layers.

ItRequiresNoSkilltoUseAny Tom, Dick, Sally or Jane can buy a microneedling machine, set up a strip-mall shop and offer it to people, says Eagan, MN dermatologist Charles E. Crutchfield III, MD, who stresses that complications can arise if you dont visit a board-certified doctor for the treatment. Instead, he recommends an ablative laser, which also boosts collagen and tightens the skin with much more sophistication.

At NewBeauty, we get the most trusted information from the beauty authority delivered right to your inbox

Find a NewBeauty "Top Beauty Doctor" Near you

Go here to see the original:
4 Doctors Reveal the Pros and Cons to Microneedling Treatments - NewBeauty Magazine

Skin Stem Cells Comments Off on 4 Doctors Reveal the Pros and Cons to Microneedling Treatments – NewBeauty Magazine | January 23rd, 2021

Led by genetic counselor Jennifer Roggenbuck, MS, LGC, a one-year grant awarded by the ALS Association is funding Ohio States formal development of national clinical guidelines for ALS genetic testing that will be used by healthcare centers nationwide. We have cared for thousands of patients since opening our ALS/MND Clinic in the mid-1990s and have extensive experience with genetic testing, says Roggenbuck. We believe its extremely important to establish national testing standards, to ensure that all persons with ALS can benefit from genetic advances, and to fuel further research.

Genetic testing and counseling directly benefits our patients, explains clinic director Stephen J. Kolb, MD, PhD. Genetic characterization of our patients also opens the door to research opportunities. In addition to formal genetic counseling, our clinic has an ALS Clinical Research Coordinator who meets with every patient to explain our basic science and clinical trial opportunities and answer any related questions. Our patient partnerships are a key factor in the size and scope of our research program. Because Ohio State is now among the largest ALS research sites in the country, were regularly asked to participate in or lead high profile National Institutes of Health (NIH) and foundation studies.

A major focus of our program is to connect the individuals that we serve in clinic to the critical research efforts that are happening in laboratories here at Ohio State as well as those throughout the world. One example of this is the development of individualized models of disease, says Dr. Kolb. We and our collaborators are able to biopsy a persons skin cells and turn them into a type of stem cell that allow us to reproduce each patients exact ALS condition in the laboratory. We can then study the models to look for causes and develop therapies on a case-by-case basis.

The ALS/MND Multidisciplinary Clinic and Research Program is part of Ohio States Neurological Institute, with one of the largest neuromuscular centers in the country, so there is an established team of multidisciplinary experts to help each patient, even those with unusual or difficult symptoms. The ALS/MND program is led by Kolb, a physician-scientist, and in addition to the full-time research coordinator, he is joined by a clinical neurologist, genetic counselor, clinical nurse practitioner, social worker and nutritionist, as well as physical, occupational, respiratory and speech therapists. The Ohio State Department of Neurology is a member of NeuroNEXT: Network for Excellence in Neuroscience Clinical Trials and a contributing member to the Northeast ALS Consortium (NEALS).

Read feature stories

Go here to read the rest:
Ohio State establishing national standards for ALS genetic testing, research and patient care | Ohio State Medical Center - Wexner Medical Center -...

Skin Stem Cells Comments Off on Ohio State establishing national standards for ALS genetic testing, research and patient care | Ohio State Medical Center – Wexner Medical Center -… | January 23rd, 2021

Regenerative Medicine Market Major Players:

Players active in the global regenerative medicine market include Osiris Therapeutics, Cook Biotech, Organogenesis, Baxter International, Inc., Stryker and RTI surgical, LifeSciences, CryoLife, Advanced Cell Technology, Sanofi, BioMimetic Therapeutics, Medtronic, StemCellsInc, and LifeCell Kinetic Concepts, among others.

ALSO READ :https://sapanas.tumblr.com/post/631130245458739200/regenerative-medicine-market-competitive-analysis

Regenerative Medicine Market Outlook

Global regenerative medicine market is growing continually, witnessing a massive uptake. Market growth primarily attributes to the increasing advancement in healthcare technology and the growing prevalence of chronic diseases. Besides, improvements in the field of regenerative medicine and stem cell technology drive the growth of the market excellently.

Moreover, the rising uptake of therapeutics such as stem cell biology, cellular therapy, tissue engineering in applications, including cord blood, oncology, urology, orthopedics, neurology, dermatology, and others accelerate the market growth. According to Market Research Future (MRFR), the global regenerative medicine market is poised to grow at 25.4% CAGR throughout the forecast period (2016 2022).

ALSO READ :https://yarabook.com/read-blog/138540

Additionally, the rising uptake of stem cell & tissue engineering processes in the treatment of health issues ranging from orthopedics, musculoskeletal & spine, dental, and skin/integumentary to cancer, neurology, and cardiology substantiate the market growth. Furthermore, the increasing rate of road accidents, injuries, and trauma cases drive the market exponentially, driving the demand for transplants & surgical reconstruction procedures.

On the other hand, factors such as the lack of awareness, skilled professionals, and stringent regulatory policies are projected to act as significant impeders for market growth. Nevertheless, funding support for the development of regenerative medicines would support the growth of the market throughout the predicted period. Also, widening application areas of regenerative medicines in the field of stem cell reconstructive and skin grafting would increase the market growth.

Global Regenerative Medicine Market Segments

The analysis is segmented into four dynamics;

By Material: Synthetic Materials, Genetically Engineered Materials, Pharmaceuticals, and others.

By Therapy: Stem Cell Biology, Cellular Therapy, Tissue Engineering, and others.

By Application: Cord Blood, Oncology, Urology, Orthopedics, Neurology, Dermatology, and others.

ALSO READ :http://www.marketwatch.com/press-release/fram-market-2021-industrytrends-opportunities-market-volume-competitive-landscape-possible-challenges-and-forecast-to-2025-2021-01-06

By Regions: Americas, Europe, Asia Pacific, Middle East & Africa, and Rest-of-the-World.

Regenerative Medicine Market Regional Analysis

North America is projected to continue dominating the globalregenerative medicine marketthroughout the forecast period. In 2015, North America accounted for more than 44% of the overall market share. This huge market growth attributes to the presence of a large number of major players and pharma & biotechnology companies. Moreover, huge investments made by public & private organizations drive the regenerative medicine industry in the region.

Besides, the rising prevalence of chronic diseases and orthopedic issues and increasing clinical trials to evaluate the therapeutic potential of products foster regional market growth. Also, the well-spread awareness towards the therapeutic potency of regenerative medicines impacts the market growth positively. The North American regenerative medicine market is expected to grow at a robust CAGR of 22.3% over the review period.

Europe stands second in the global regenerative medicine market. Factors such as the increasing per capita healthcare expenses and penetration of healthcare sectors in the region boost the market growth. Additionally, the rising government support and R&D funding in the life science developments substantiate the regional market growth. Markets in the UK, Germany, and France, contribute to the regional market majorly. The European regenerative medicine market is estimated to grow at 22.5% CAGR during the assessment period.

ALSO READ :http://www.marketwatch.com/press-release/m2m-communication-market-demand-to-rise-amid-industrial-automation-industry-analysis-with-business-trends-covid19-outbreak-competitor-strategyforecast-to-2023-2021-01-05

The Asia Pacific regenerative medicine market has emerged as a rapidly growing market. Factors such as the large advances in biotechnology and increasing government support for R&D are fostering the growth of the regional market. Regenerative medicine markets in highly populated countries such as China, India, and Japan support the regional market growth excellently, heading with huge technological advances. The APAC Regenerative Medicine market is predicted to demonstrate huge growth potential.

Global Regenerative Medicine Market Competitive Analysis

The well-established regenerative medicine market appears to be highly competitive with the presence of several notable players. To gain a larger competitive advantage, market players incorporate strategic initiatives such as mergers & acquisitions, expansions, and product/technology launch. Also, they make substantial investments to drive R&D to develop their capabilities and to expand their global footprints. Simultaneously, R&D funding programs initiated by the governments to enhance regenerative medicine capabilities are offering high growth potential. This is further going to attract several new entrants to the market and intensify the market competition further.

Regenerative Medicine Industry/Innovations/Related News:

March 15, 2020 - Research team at the University of Sheffield published their study on stem cell mutations that could improve regenerative medicine in the magazine Stem Cell Reports. Their study gives new insights into the cause of mutations in pluripotent stem cells and potential ways of stopping these mutations from occurring. It also suggests ways to reduce the likelihood of variations occurring in these cells when cultured. There is considerable interest in using Pluripotent stem cells to produce cells that can replace diseased or damaged tissues in applications referred to as regenerative medicine.

ALSO READ :http://www.marketwatch.com/press-release/waste-to-energy-market-share-size-key-players-regional-study-and-forecast-2024-2020-12-30

https://neighborwebsj.com/

Read this article:
Global Regenerative Medicine Market Insights, Overview, Analysis and Forecast 2022 NeighborWebSJ - NeighborWebSJ

Skin Stem Cells Comments Off on Global Regenerative Medicine Market Insights, Overview, Analysis and Forecast 2022 NeighborWebSJ – NeighborWebSJ | January 23rd, 2021

Request Download SampleAsk For Discount Company Profile

New Jersey, United States,- Stem Cell Therapy Market Report gives a detailed analysis of the market. After a detailed examination of the current trends, the report shares the details around the factors fueling the markets momentum.

Forgiving an in-depth review of the market, the report showcases the factors that are affecting the markets overall growth. From network partners, production methods to revenue generating techniques, every detail is added in the report. In addition, the Stem Cell Therapy report has enclosed the data about the established players of the market.

Stem Cell Therapy report has a dedicated section that highlights the actions that can be appointed for global level expansion. The report is designed to guide through every step from planning till implementation.

The major players covered in the Stem Cell Therapy market are

Osiris Therapeutics Medipost Co. Ltd. Anterogen Co. Ltd. Pharmicell Co. Ltd. HolostemTerapieAvanzateSrl JCR Pharmaceuticals Co. Ltd. Nuvasive RTI Surgical Allosource

It is worth noting that the Stem Cell Therapy market report also gives a complete overview in terms of volume, market value, demand and supply. All these factors add up to become the market dynamics of the Stem Cell Therapy market. For leaping ahead of the competition and to make the most out of the emerging opportunities, it is essential to understand the market dynamics.

As per the Verified Market Reports experts, the Stem Cell Therapy market is going to balloon in terms of revenue and customer base. This conclusion was drawn out from the market indicators that are considered in the Stem Cell Therapy market report to form curated data. The crucial pieces of data are included in the form of tables, charts and graphs to give a visual representation of the complex and huge database.

What key insights does the Stem Cell Therapy market research provide?

Past and current revenue statistics of the Stem Cell Therapy market players analyzed at the regional level. Individual profiling of major stakeholders. Analysis of the Stem Cell Therapy market size on the basis of product type and end-use type. Accurate Stem Cell Therapy market forecast of volume in numbers and percentages. Demand prospect of individual segments covered in the Stem Cell Therapy report.

Segmentation of Stem Cell Therapy Market:

1.Stem Cell Therapy Market, By Cell Source:

Adipose Tissue-Derived Mesenchymal Stem Cells Bone Marrow-Derived Mesenchymal Stem Cells Cord Blood/Embryonic Stem Cells Other Cell Sources

2.Stem Cell Therapy Market, By Therapeutic Application:

Musculoskeletal Disorders Wounds and Injuries Cardiovascular Diseases Surgeries Gastrointestinal Diseases Other Applications

3.Stem Cell Therapy Market, By Type:

Allogeneic Stem Cell Therapy Market, By Application Musculoskeletal Disorders Wounds and Injuries Surgeries Acute Graft-Versus-Host Disease (AGVHD) Other Applications Autologous Stem Cell Therapy Market, By Application Cardiovascular Diseases Wounds and Injuries Gastrointestinal Diseases Other Applications

Stem Cell Therapy Market Report Scope

What queries are resolved by the Stem Cell Therapy market research?

1. What are the restraints slowing down the progress of Stem Cell Therapy market?2. Why are the end consumers getting more inclined towards alternative Stem Cell Therapy market products?3. How the Stem Cell Therapy market expected to shape in the next septennial?4. What strategies are being appointed by the major players of the Stem Cell Therapy market to stay ahead of the competition?5. What innovative technologies are being used by the established players of the Stem Cell Therapy market to stay ahead of the competition?

Why choose Verified Market Reports?

Smart dashboard to provide details about updated industry trends. Data collection from different network partners such as suppliers, vendors, service providers, for giving out a clear perspective of the Stem Cell Therapy market. Strict quality checking standards Data collection, triangulation, and validation. 24/7 at your service.

Visualize Stem Cell Therapy Market using Verified Market Intelligence:-

Verified Market Intelligence is our BI enabled platform for narrative storytelling of this market. VMI offers in-depth forecasted trends and accurate Insights on over 20,000+ emerging & niche markets, helping you make critical revenue impacting decisions for a brilliant future.

VMI provides a holistic overview and global competitive landscape with respect to Region, Country, and Segment and Key players of your market. Present your Market Report & findings with inbuilt presentation feature saving over 70% of your time and resources for Investor, Sales & Marketing, R&D and Product Development pitches. VMI enables data delivery In Excel and Interactive PDF formats with over 15+ Key Market Indicators for your market.

About Us: Verified Market Reports

Verified Market Reports is a leading Global Research and Consulting firm servicing over 5000+ global clients. We provide advanced analytical research solutions while offering information enriched research studies.

We also offer insights into strategic and growth analyses and data necessary to achieve corporate goals and critical revenue decisions.

Our 250 Analysts and SMEs offer a high level of expertise in data collection and governance using industrial techniques to collect and analyse data on more than 25,000 high impact and niche markets. Our analysts are trained to combine modern data collection techniques, superior research methodology, expertise, and years of collective experience to produce informative and accurate research.

Our research spans over a multitude of industries including Energy, Technology, Manufacturing and Construction, Chemicals and Materials, Food and Beverages etc. Having serviced many Fortune 2000 organizations, we bring a rich and reliable experience that covers all kinds of research needs.

Contact us:

Mr. Edwyne Fernandes

US: +1 (650)-781-4080UK: +44 (753)-715-0008APAC: +61 (488)-85-9400US Toll-Free: +1 (800)-782-1768

Email: sales@verifiedmarketreports.com

Website: https://www.verifiedmarketreports.com/

Link:
Stem Cell Therapy Market Size, Growth Opportunities, Trends, Key Players and Forecast to 2027 - The Courier

Bone Marrow Stem Cells Comments Off on Stem Cell Therapy Market Size, Growth Opportunities, Trends, Key Players and Forecast to 2027 – The Courier | January 23rd, 2021

The market research report titled Cell Isolation Market by Product (Instruments and Consumables), by Cell Type (Animal and Human), by Cell Source (Adipose Tissue, Embryonic/Cord Blood Stem Cells, and Bone Marrow), by Technique (Surface Marker-Based Cell Isolation, Centrifugation-Based Cell Isolation, and Filtration-Based Cell Isolation), by Application (Cancer Research, Biomolecule Isolation, Tissue Regeneration & Regenerative Medicine, Stem Cell Research, In Vitro Diagnostics, and Others), and By End-User (Hospitals & Diagnostic Laboratories, Research Laboratories & Institutes, Biotechnology & Biopharmaceutical Companies, and Others): Global Industry Perspective, Comprehensive Analysis, and Forecast, 20182025 published by Zion Market Research provides an insightful comprehension about the growth aspects, dynamics, and working of the globalCell IsolationMarket. The report entails details about the market with data collected over the years with its wide-ranging analysis. It also comprises the competitive landscape within the market together with a detailed evaluation of the leading players within the global Cell Isolation Market. In addition, it sheds light on the profiles of the key vendors/manufacturers comprising thorough assessment of the market share, production technology, market entry strategies, revenue forecasts, and so on. Further, the report will encompass the fundamental strategic activities such as product developments, mergers & acquisitions, launches, events, partnerships, collaborations, and so on. Apart from this, it will also present the new entrants contributing their part in the market growth.

FREE | Request Sample is Available @https://www.zionmarketresearch.com/sample/cell-isolation-market

Global Cell Isolation Market: Competitive Players

Becton, Dickinson, and Company, Thermo Fisher Scientific, Inc., Merck KGaA, Beckman Coulter Inc., Terumo BCT, Bio-Rad Laboratories, Inc.

The Cell Isolation Market report also entails exhaustive examination of the key factors likely to propel or restrict the expansion of the global Cell Isolation Market during the forecast period in addition to the most recent and promising future trends in the market. Moreover, the report uses SWOT analysis and other methodologies to analyze the numerous segments [Product, Applications, End-Users, and Major Regions] of the global Cell Isolation Market. Furthermore, it comprises valuable understanding about the segments like their growth potential, market share, and developments. It also evaluates the market on the basis of its major geographical regions [Latin America, North America, Asia Pacific, Middle & East Africa, and Europe]. It entails quantitative and qualitative facets of the market in association to each country and region enlisted in the report.

Promising Regions & Countries Mentioned In The Cell Isolation Market Report:

Download Free PDF Report Brochure @https://www.zionmarketresearch.com/requestbrochure/cell-isolation-market

The Cell Isolation Market report also stipulates the computed expected CAGR of the market estimated on the basis of the existing and previous records concerning the global Cell Isolation Market. The report analyzes the market with the aim of being capable to get a clear picture of prevailing and anticipated growth patterns of the market. Furthermore, it entails the impact of numerous federal policies and rules on the growth and dynamics of the market during the forecast period. The thorough assessment put forth by our analysts assist to get more profound acquaintance of global markets and related industries. In addition, the report encompasses various tactics to discover the weaknesses, opportunities, risks, and strengths having the potential to impact the global market expansion.

Impact of COVID-19 (Coronavirus):The report will also entail a dedicated section assessing the influence of COVID-19 on the expansion of the global Cell Isolation Market during the coming period.

Report Customization:Clients can request for customization of report as per their need for additional data.

Apart from this, our team will be accessible around the clock to our clients for any kind of assistance.

Inquire more about this report @https://www.zionmarketresearch.com/inquiry/cell-isolation-market

Key Details & USPs of the Existing Report Study:

Request coronavirus impact analysis on sectors and market

Request Report TOC (Table of Contents) @https://www.zionmarketresearch.com/toc/cell-isolation-market

What Reports Provides

Also, Research Report Examines:

Thanks for reading this article;you can also get individual chapter wise section or region wise report version like North America, Europe or Asia.

See more here:
Global Cell Isolation Market SWOT Analysis, Key Indicators, Forecast 2027 : Becton, Dickinson, and Company, Thermo Fisher Scientific KSU | The...

Bone Marrow Stem Cells Comments Off on Global Cell Isolation Market SWOT Analysis, Key Indicators, Forecast 2027 : Becton, Dickinson, and Company, Thermo Fisher Scientific KSU | The… | January 23rd, 2021

The Global Adipose Derived Stem Cell Therapy Market report provides a holistic evaluation of the market for the forecast period (20192025). The report comprises various segments as well as an analysis of the trends and factors that are playing a substantial role in the market. These factors; the market dynamics involve the drivers, restraints, opportunities and challenges through which the impact of these factors in the market are outlined. The drivers and restraints are intrinsic factors whereas opportunities and challenges are extrinsic factors of the market. The Global Adipose Derived Stem Cell Therapy Market study provides an outlook on the development of the market in terms of revenue throughout the prognosis period.

In order to present an executive-level model of the market and its future perspectives, the Adipose Derived Stem Cell Therapy Market report presents a clear segmentation based on different parameters. The factors that affect these segments are also discussed in detail in the report.

Adipose derived stem cells (ADSCs) are stem cells derived from adipocytes, and can differentiate into variety of cell types. ADSCs have multipotency similar to bone marrow mesenchymal stem cells, thus ADSCs substitute for bone marrow as a source of stem cells. Numerous manual and automatic stem cell separation procedures are adopted in order to separate adipose stem cells (ASCs) from adipose tissue. Flow cytometry can also be used to isolate ADSCs from other stem cells within a cell solution.

Major Players included in this report are as follows BioRestorative Therapies, Inc., Celltex Therapeutics Corporation, Antria, Inc., Cytori Therapeutics Inc., Intrexon Corporation, Mesoblast Ltd., iXCells Biotechnologies, Pluristem Therapeutics, Inc., Thermo Fisher Scientific, Inc., Tissue Genesis, Inc., Cyagen US Inc., Celprogen, Inc., and Lonza Group, among others.

Get PDF Brochure Of This Research Report @ https://www.coherentmarketinsights.com/insight/request-pdf/2357

Adipose Derived Stem Cell Therapy Market: Regional analysis includes:

The study will also feature the key companies operating in the industry, their product/business portfolio, market share, financial status, regional share, segment revenue, SWOT analysis, key strategies including mergers & acquisitions, product developments, joint ventures & partnerships an expansions among others, and their latest news as well. The study will also provide a list of emerging players in the Adipose Derived Stem Cell Therapy Market.

Adipose Derived Stem Cell Therapy Market scope

A basic summary of the competitive landscape A detailed breakdown of the regional expanse A short overview of the segmentation

Furthermore, this study will help our clients solve the following issues:

Cyclical dynamics We foresee dynamics of industries by using core analytical and unconventional market research approaches. Our clients use insights provided by us to maneuver themselves through market uncertainties and disruptions.

Identifying key cannibalizes Strong substitute of a product or service is the most prominent threat. Our clients can identify key cannibalizes of a market, by procuring our research. This helps them in aligning their new product development/launch strategies in advance.

Spotting emerging trends Our Ecosystem offering helps the client to spot upcoming hot market trends. We also track possible impact and disruptions which a market would witness by a particular emerging trend. Our proactive analysis helps clients to have an early mover advantage.

Interrelated opportunities This report will allow clients to make decisions based on data, thereby increasing the chances that the strategies will perform better if not best in the real world.

Request Sample Copy of Research Report @ https://www.coherentmarketinsights.com/insight/request-sample/2357

Some of the Major Highlights of TOC covers:

Adipose Derived Stem Cell Therapy Regional Market Analysis

Adipose Derived Stem Cell Therapy Production by Regions Global Adipose Derived Stem Cell Therapy Production by Regions Global Adipose Derived Stem Cell Therapy Revenue by Regions Adipose Derived Stem Cell Therapy Consumption by Regions

Adipose Derived Stem Cell Therapy Segment Market Analysis (by Type)

Global Adipose Derived Stem Cell Therapy Production by Type Global Adipose Derived Stem Cell Therapy Revenue by Type Adipose Derived Stem Cell Therapy Price by Type

Adipose Derived Stem Cell Therapy Segment Market Analysis (by Application)

Global Adipose Derived Stem Cell Therapy Consumption by Application Global Adipose Derived Stem Cell Therapy Consumption Market Share by Application (2014-2019)

Adipose Derived Stem Cell Therapy Major Manufacturers Analysis

Adipose Derived Stem Cell Therapy Production Sites and Area Served Product Introduction, Application and Specification Adipose Derived Stem Cell Therapy Production, Revenue, Ex-factory Price and Gross Margin (2014-2019)Main Business and Markets Served

Key questions answered in the report:

LIMITED TIME OFFER Hurry Up!

Get Discount For Buyers UPTO 30% OFF On Any Research Report

Apply Promo Code CMIFIRST1000 And Get Instant Discount Of USD 1000

Ask For Discount Before Purchasing This Business Report @ https://www.coherentmarketinsights.com/insight/request-discount/2357

Key Benefits

Major countries in each region are mapped according to individual market revenue. Comprehensive analysis of factors that drive and restrict market growth is provided. The report includes an in-depth analysis of current research and clinical developments within the market. Key players and their key developments in recent years are listed.And More.

About Coherent Market Insights

Coherent Market Insights is a prominent market research and consulting firm offering action-ready syndicated research reports, custom market analysis, consulting services, and competitive analysis through various recommendations related to emerging market trends, technologies, and potential absolute dollar opportunity.

Contact Us

Mr. ShahCoherent Market Insights1001 4th Ave, #3200Seattle, WA 98154Tel: +1-206-701-6702Email: sales@coherentmarketinsights.com

Originally posted here:
Adipose Derived Stem Cell Therapy Market 2018: Production, Sales, Supply, Demand, Analysis and Forecast To 2026 | BioRestorative Therapies, Inc.,...

Bone Marrow Stem Cells Comments Off on Adipose Derived Stem Cell Therapy Market 2018: Production, Sales, Supply, Demand, Analysis and Forecast To 2026 | BioRestorative Therapies, Inc.,… | January 23rd, 2021

Researchers at the National Institutes of Health have discovered a new genetic disorder characterized by developmental delays and malformations of the brain, heart and facial features.

Named linkage-specific-deubiquitylation-deficiency-induced embryonic defects syndrome (LINKED), it is caused by a mutated version of theOTUD5gene, which interferes with key molecular steps in embryo development. The findings indicate that the newly identified pathway may be essential for human development and may also underlie other disorders that are present at birth. The information will help scientists better understand such diseases both common and rare and improve patient care. The results were reported Jan. 20, 2021 inScience Advances.

Our discovery of the dysregulated neurodevelopmental pathway that underlies LINKED syndrome was only possible through the teamwork of geneticists, developmental biologists and biochemists from NIH, said Achim Werner, Ph.D., an investigator at the National Institute of Dental and Craniofacial Research (NIDCR) and lead author. This collaboration provided the opportunity to pinpoint the likely genetic cause of disease, and then take it a step further to precisely define the sequence of cellular events that are disrupted to cause the disease.

The project began when David B. Beck, M.D., Ph.D., a clinical fellow in the laboratory of Dan Kastner M.D., Ph.D., at the National Human Genome Research Institute (NHGRI) and co-first author, was asked to consult on a male infant who had been born with severe birth defects that included abnormalities of the brain, craniofacial skeleton, heart and urinary tract. An in-depth examination of siblings and family members genomes, combined with genetic bioinformatics analyses, revealed a mutation in theOTUD5gene as the likely cause of the condition. Through outreach to other researchers working on similar problems, Beck found seven additional males ranging from 1 to 14 years of age who shared symptoms with the first patient and had varying mutations in theOTUD5gene.

The gene contains instructions for making the OTUD5 enzyme, which is involved in ubiquitylation, a process that molecularly alters a protein to change its function. Ubiquitylation plays a role in governing cell fate, where stem cells are instructed to become specific cell types in the early stages of embryo development.

Based on the genetic evidence, I was pretty sureOTUD5mutations caused the disease, but I didnt understand how this enzyme, when mutated, led to the symptoms seen in our patients, said Beck. For this reason we sought to work with Dr. Werners group, which specializes in using biochemistry to understand the functions of enzymes like OTUD5.

To start, the NIH team examined cells taken from patient samples, which were processed at the NIH Clinical Center. Normally, OTUD5 edits or removes molecular tags on certain proteins (substrates) to regulate their function. But in cells from patients withOTUD5mutations, this activity was impaired.

Using a method to return mature human cells to the stem cell-like state of embryo cells, the scientists found thatOTUD5mutations were linked to abnormalities in the development of neural crest cells, which give rise to tissues of the craniofacial skeleton, and of neural precursors, cells that eventually give rise to the brain and spinal cord.

In further experiments, the team discovered that the OTUD5 enzyme acts on a handful of protein substrates called chromatin remodelers. This class of proteins physically alters the tightly packed strands of DNA in a cells nucleus to make certain genes more accessible for being turned on, or expressed.

With help from collaborators led by Pedro Rocha Ph.D., an investigator at the National Institute of Child Health and Human Development (NICHD), the team found that chromatin remodelers targeted by OTUD5 help enhance expression of genes that control the cell fate of neural precursors during embryo development.

Taken together, the researchers concluded, OTUD5 normally keeps these chromatin remodelers from being tagged for destruction. But when OTUD5 is mutated, its protective function is lost and the chromatin remodelers are destroyed, leading to abnormal development of neural precursors and neural crest cells. Ultimately, these changes can lead to some of the birth defects seen in LINKED patients.

Several of the chromatin remodelers OTUD5 interacts with are mutated in Coffin Siris and Cornelia de Lange syndromes, which have clinically overlapping features with LINKED syndrome, said Werner. This suggests that the mechanism we discovered is part of a common developmental pathway that, when mutated at various points, will lead to a spectrum of disease.

We were surprised to find that OTUD5 elicits its effects through multiple, functionally related substrates, which reveals a new principle of cellular signaling during early embryonic development, said Mohammed A. Basar, Ph.D., a postdoctoral fellow in Werners lab and co-first author of the study. These findings lead us to believe that OTUD5 may have far-reaching effects beyond those identified in LINKED patients.

In future work, Werners team plans to more fully investigate the role that OTUD5 and similar enzymes play in development. The researchers hope the study can serve as a guiding framework for unraveling the causes of other undiagnosed diseases, ultimately helping clinicians better assess and care for patients.

Were finally able to provide families with a diagnosis, bringing an end to what is often a long and exhausting search for answers, said Beck.

Reference: Beck DB, Basar MA, Asmar AJ, et al. Linkage-specific deubiquitylation by OTUD5 defines an embryonic pathway intolerant to genomic variation. Sci Adv. 2021;7(4):eabe2116. doi:10.1126/sciadv.abe2116.

This article has been republished from the following materials. Note: material may have been edited for length and content. For further information, please contact the cited source.

Original post:
New Genetic Disorder Discovered That Affects Brain and Craniofacial Skeleton - Technology Networks

Spinal Cord Stem Cells Comments Off on New Genetic Disorder Discovered That Affects Brain and Craniofacial Skeleton – Technology Networks | January 23rd, 2021

Have researchers in Scotland truly found a way to reverse the damage done to nerve cells by motor neurone disease (MND)?

A new study suggests that it all comes down to boosting the energy output from the mitochondria, the cells power supply.

How can that be done? Possibly with drugs that already exist.

The researchers, from the University of Edinburgh, are already looking for existing drugs that boost mitochondrial function and may be able to be repurposed to treat MND.

Overall, this is a startling development, albeit one that has to be tempered with wait-and-see caution. There are thousands of people around the world, sufferers and their families, desperate for even a glimmer of good news.

People with MNDprogressively lose the use of their limbs and ability to speak, swallow and breathe, whilst their mind and senses usually remain intact.

The average life expectancy is two and a half years.

Motor neuron cells are nerve cells that control movement. An axon is the long part of the motor neuron cell that connects to the muscle and it can be up to a metre long.

The starting point in the study was examining axonal dysfunction a common problem in neurodegenerative disorders, including in amyotrophic lateral sclerosis (ALS), a form of MND.

For axons to function properly, they need a lot of energy. The scientists wondered if the production of energy in the cells is put out of whack by MND. And if that was true, could it be fixed and if so, could the axon be restored to full function?

The researchers from the Euan MacDonald Centre for MND Research at the University of Edinburgh used stem cells taken from people with the C9orf72 gene mutation that causes both MND and frontotemporal dementia.

They discovered that, in these human stem cell models of MND, the axon was shorter than in healthy cells.

The study then found the back-and-forth movement along the axon was impaired.

And then, bingo! Once the mitochondrial performance was boosted, the axon think of a stunted tree suddenly getting water and nourishment regained its healthy function. Back to normal.

This then allowed the mitochondria to travel freely along the axon.

The study also examined human post-mortem spinal cord tissue from people with MND. The tissue was obtained from the Medical Research Council Edinburgh Brain and Tissue Bank.

These examinations supported the findings from the stem cells.

The first film shows mitochondria travelling along an axon in a healthy motor neuron:

data-s="video/mp4">

This second film shows how the mitochondria becomes stalled as it attempts to travel along damaged motor neuron with the C9orf72 gene:

data-s="video/mp4">

In this third film we see a damaged motor neuron with the C9orf72 gene restored to function after boosting the mitochondria:

data-s="video/mp4">

Dr Arpan Mehta, the Lady Edith Wolfson Fellow and a PhD student at the University of Edinburgh, led the study. In a prepared statement he said:

The importance of the axon in motor nerve cells cannot be understated. Our data provides hope that by restoring the cells energy source we can protect the axons and their connection to muscle from degeneration.

Work is already underway to identify existing licensed drugs that can boost the mitochondria and repair the motor neurons. This will then pave the way to test them in clinical trials.

Although the research focused on the people with the commonest genetic cause of the ALS (amyotrophic lateral sclerosis) type of MND, researchers are hopeful that the results will also apply to other forms of the disease.

By the way: Frontotemporal dementia is a consequence of progressive damage to the frontal and/or temporal lobes of the brain.The right and left frontal lobes at the front of the brain are involved in mood, social behaviour, attention, judgement, planning and self-control.

Hence, damage can lead to reduced intellectual abilities and changes in personality, emotion and behaviour.

More than 2000 people have MND in Australia, of whom 60 per cent are male and 40 per cent female, according to figures from MND Australia.

The mean time from onset to confirmation of diagnosis is 10 to 18 months, and approximately 58 per cent of people with MND are under 65.

See the rest here:
Motor neurone disease: Researchers dare to hope existing drugs can reverse the deadly nerve damage - The New Daily

Spinal Cord Stem Cells Comments Off on Motor neurone disease: Researchers dare to hope existing drugs can reverse the deadly nerve damage – The New Daily | January 23rd, 2021

DILLON Dylan Pope concurs that 2020 was, by and large, not a great year. But he still found a way to make the most of it.

"It was a pretty tough year but having this to look forward to and reflect on has been something pretty big for me," he said.

Pope, a Montana Western defensive back, made the decision to donate bone marrow in December.

"I was nervous, but I was excited to help somebody," Pope said.

At the encouragement of his sister, Mariah, Pope registered with a non-profit called Be The Match in March, shortly after coronavirus knocked the world off kilter.

According to the organization's website, only one out of every 430 registered members will actually go on to donate bone marrow. Pope's sister has been registered for years without a match.

So, Pope was understandably taken aback when, after a little more than three months, he received a call telling him that he had been deemed a suitable donor for an anonymous recipient to receive his blood stem cells, which are derived from bone marrow.

"At first I thought it was fake," Pope said. "I didn't think there was any way it was going to happen after just three months."

With a donation date set in December -- because of confidentiality policies, Pope can't disclose what state or hospital the procedure took place at -- the next months were what one would expect: a lot of paperwork and a lot of blood tests.

The week before the donation, he began receiving daily injections to increase his stem cell count. He then made the trip with his younger brother, Brayton.

The process took eight hours and required only local anesthesia. A needle in his right arm drew blood, ran it through a machine that extracted stem cells and then a needle in his left arm injected blood back into his body.

"It's really not nearly as scary when you get there as you think it's going to be," Pope said.

It'll be a year before Pope learns the identity of who received his bone marrow. He's certain it'll be a moving, powerful experience.

"I bet it'll be pretty emotional thing for both of us, because it was pretty cool to be able to help them," Pope said.

Ryan Nourse, Montana Western's head football coach, said he wasn't surprised by Pope's willingness to donate bone marrow and said he and the program supported him the entire way.

"I think that's a really brave thing, courageous thing for Dylan to go do," Nourse said. "I think that selflessness will shine through to the other guys knowing that maybe I could help somebody in a similar position someday."

More here:
'I was excited to help somebody': Montana Western's Dylan Pope reflects on donating bone marrow - MontanaSports

Bone Marrow Stem Cells Comments Off on ‘I was excited to help somebody’: Montana Western’s Dylan Pope reflects on donating bone marrow – MontanaSports | January 22nd, 2021

By providing an absolute overview of the market, Global Bone Marrow-Derived Stem Cells (BMSCS) Market report covers various aspects of market analysis, product definition, market segmentation, key developments, and the existing vendor landscape. Such market insights can be accomplished with this comprehensive Global Bone Marrow-Derived Stem Cells (BMSCS) Market research report which takes into account all the aspects of current and future market. The report provides wide-ranging analysis of the market structure along with the estimations of the various segments and sub-segments of the market. This Global Bone Marrow-Derived Stem Cells (BMSCS) Market research report delivers an analytical measurement of the main challenges faced bythe business currently and in the upcoming years.

Bone marrow-derivedstem cells(BMSCS) market is expected to gain market growth in the forecast period of 2020 to 2027. Data Bridge Market Research analyses the market to growing at a CAGR of 10.4% in the above-mentioned forecast period. Increasing awareness regarding the benefits associates with the preservation of bone marrow derived stem cells will boost the growth of the market.

Get Sample Report + All Related Graphs & Charts @https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-bone-marrow-derived-stem-cells-bmscs-market

The major players covered in the bone marrow-derived stem cells (BMSCS) market report are CBR Systems, Inc, Cordlife Sciences India Pvt. Ltd., Cryo-Cell International, Inc.ESPERITE N.V., LifeCell International Pvt. Ltd., StemCyte India Therapeutics Pvt. Ltd, PerkinElmer Inc, Global Cord Blood Corporation., Smart Cells International Ltd., Vita 34 among other domestic and global players.

Some of the factors such as introduction of novel technologies for the preservation of stem cells and their storage, surging investment that will help in research activities leading to stem cells benefits, adoption of hemotopoietic stem cell transplantation system will accelerate the growth of the bone marrow-derived stem cells (BMSCS) market in the forecast period of 2020-2027. Various factors that will create opportunities in the bone marrow-derived stem cells (BMSCS) market are increasing occurrences of various diseases along with rising applications in emerging economies.

Large cost of operation and strict regulatory framework will restrict the growth of bone marrow-derived stem cells (BMSCS) market in the above mentioned forecast period. Ethical concern leading to stem cells will become the biggest challenge in the market growth.

Global Bone Marrow-Derived Stem Cells (BMSCS) Market By Service Type (Sample Preservation and Storage, Sample Analysis, Sample Processing, Sample Collection and Transportation), Application (Personalized Banking Applications, Research Applications, Clinical Applications), Country (U.S., Canada, Mexico, Germany, Italy, U.K., France, Spain, Netherland, Belgium, Switzerland, Turkey, Russia, Rest of Europe, Japan, China, India, South Korea, Australia, Singapore, Malaysia, Thailand, Indonesia, Philippines, Rest of Asia- Pacific, Brazil, Argentina, Rest of South America, South Africa, Saudi Arabia, UAE, Egypt, Israel, Rest of Middle East & Africa), Market Trends and Forecast to 2027

Global Bone Marrow-Derived Stem Cells (BMSCS) Market Scope and Market Size

Bone marrow-derivedstem cells(BMSCS) market is segmented on the basis of service type and application. The growth amongst these segments will help you analyse meagre growth segments in the industries, and provide the users with valuable market overview and market insights to help them in making strategic decisions for identification of core market applications.

Thisbonemarrow-derived stem cells (BMSCS) market report provides details of new recent developments, trade regulations, import export analysis, production analysis, value chain optimization, market share, impact of domestic and localised market players, analyses opportunities in terms of emerging revenue pockets, changes in market regulations, strategic market growth analysis, market size, category market growths, application niches and dominance, product approvals, product launches, geographic expansions, technological innovations in the market. To gain more info on bone marrow-derived stem cells (BMSCS) market contactData Bridge Market Researchfor anAnalyst Brief, our team will help you take an informed market decision to achieve market growth.

Grab Your Report at an Impressive 30% Discount! Please click Here @

https://www.databridgemarketresearch.com/inquire-before-buying/?dbmr=global-bone-marrow-derived-stem-cells-bmscs-market

Bone Marrow-Derived Stem Cells (BMSCS) Market Country Level Analysis

Bone marrow-derivedstem cells(BMSCS) market is analysed and market size insights and trends are provided by country, service type and application as referenced above.

The country section of the bone marrow-derivedstem cells(BMSCS) market report also provides individual market impacting factors and changes in regulation in the market domestically that impacts the current and future trends of the market. Data points such as consumption volumes, production sites and volumes, import export analysis, price trend analysis, cost of raw materials, down-stream and upstream value chain analysis are some of the major pointers used to forecast the market scenario for individual countries. Also, presence and availability of global brands and their challenges faced due to large or scarce competition from local and domestic brands, impact of domestic tariffs and trade routes are considered while providing forecast analysis of the country data.

Healthcare Infrastructure Growth Installed Base and New Technology Penetration

Bone marrow-derived stem cells (BMSCS) market also provides you with detailed market analysis for every country growth in healthcare expenditure for capital equipments, installed base of different kind of products for bone marrow-derived stem cells (BMSCS) market, impact of technology using life line curves and changes in healthcare regulatory scenarios and their impact on the bone marrow-derived stem cells (BMSCS) market. The data is available for historic period 2010 to 2018.

For More Insights Get Detailed TOC @ https://www.databridgemarketresearch.com/toc/?dbmr=global-bone-marrow-derived-stem-cells-bmscs-market

Key Highlights of Report

Competitive Landscape and Bone Marrow-Derived Stem Cells (BMSCS) Market Share Analysis

Bone marrow-derived stem cells (BMSCS) market competitive landscape provides details by competitor. Details included are company overview, company financials, revenue generated, market potential, investment in research and development, new market initiatives, global presence, production sites and facilities, production capacities, company strengths and weaknesses, product launch, product width and breadth, application dominance. The above data points provided are only related to the companies focus related to bone marrow-derived stem cells (BMSCS) market.

About Data Bridge Market Research:

Data Bridge Market Researchset forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavors to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process.

Contact:

Data Bridge Market Research

US: +1 888 387 2818

UK: +44 208 089 1725

Hong Kong: +852 8192 7475

Email:Corporatesales@databridgemarketresearch.com

Read the original:
Global Bone Marrow-Derived Stem Cells (BMSCS) Market 2021 Overview, Trends, Growth Factors and Leading Players With Detailed Analysis of Industry...

Bone Marrow Stem Cells Comments Off on Global Bone Marrow-Derived Stem Cells (BMSCS) Market 2021 Overview, Trends, Growth Factors and Leading Players With Detailed Analysis of Industry… | January 22nd, 2021

Brave youngster Evie Hodgson has finally undergone a life-saving bone marrow transplant after one last "twist in the tale" saw the delivery of the stem cells delayed.

Evie, eight, from Sleights near Whitby, began preparations for the transplant earlier this year and has now finally been given the "magic stem cells".

It's not been an easy journey for Evie and her family, who were devastated in August 2020 when a potential donor pulled out at the last minute, and they faced another sudden bump in the road prior to her receiving her first round of treatment today (Friday).

The operation for the eight-year-old was scheduled for 2pm yesterday (Thursday) at The Great Northern Children's Hospital in Newcastle but the cells got stuck in London after coronavirus "caused major issues to the flight schedule".

It meant that Evie and her family had to wait another day for the operation to go ahead, but her mother Tina gave an update today to say that they were "up and running" after what had been an "emotional experience".

She said earlier today: "We have fought so hard to get to this point and Evie is so happy. It really is wonderful.

"Evie's hero donated a phenomenal amount of stem cells so she gets two sittings. The second one will be around dinner time so she gets to do it all again."

The courageous pupil at Fyling Hall School, in Robin Hood's Bay, was diagnosed with aplastic anaemia, also known as bone marrow failure, last year during the start of the covid-19 pandemic.

The youngster captured the attention of the nation when her perfect donor pulled out at the last minute and her transplant hopes were dashed.

But Evie revealed it was " the best Christmas present ever" to find another donor in December.

The family have thanked everybody who has supported them, shared Evie's story and signed up to the stem cell register following their inspirational campaign.

You can join on the DKMS register, here, or through Anthony Nolan register, here.

A dedicated Facebook page has been set up to follow Evie's journey with aplastic anaemia, which you can follow here.

Here is the original post:
Brave Evie Hodgson from Sleights finally has bone marrow transplant after one last 'twist in the tale' - Yorkshire Live

Bone Marrow Stem Cells Comments Off on Brave Evie Hodgson from Sleights finally has bone marrow transplant after one last ‘twist in the tale’ – Yorkshire Live | January 22nd, 2021

Mesoblast, MESO, is an Australian based biopharmaceutical company that has been a market favorite, even though the companys ups and downs have confused many investors.

The MESO share price has been inconsistent lately. This has prompted many investors to ask why. Analyzed carefully, MESO has done better than many stem cell businesses. Most stem cell businesses fail to ever make a profit and fail to even get a product to market. This can cause long-term problems with the stock price of any company.

ByMichael A. Mannen, MS

Mesoblast as a company is committed to offering groundbreaking cellular therapies for the treatment of many severe diseases using Mesenchymal Stem Cells. They are dedicated to cellular medicines and leveraging their stem cell technology. There are not many successful companies in this niche.

Adult stem cells are undifferentiated cells that divide and rebuild the damaged tissue. Mesenchymal Stem Cells are a type of adult stem cells generated from some of the adult tissues present in the body.

Stem cells have been found by scientists to have two properties: self-renewal and the potential to divide into specialized cell types. Multi-potent, mesenchymal stem cells are found to be present in many adult tissues. The bone marrow is considered by many scientists to be the most usable reservoir of adult human stem cells.

For several disorders, such as heart failure, the capacity to rebuild tissue may be groundbreaking for treatment. And this has been the inspiration for many companies exploring stem cell therapies.

However, what differentiates Mesoblast from other stem cell companies is its approach to treating inflammatory diseases. Their products have the potential to make breakthroughs a reality for many diseases.

The company has developed and manufactured its own patented mesenchymal lineage cells to be used for a range of ailments. These have a potential for the regeneration of tissues. These cells, however, secrete a number of biomolecules which can help the body heal more than just tissue damage. They may be important to supporting immune responses needed for recovery in many diseases.

Possible rejection of the patients immune system is the biggest problem with the use of stem cell therapies in heart diseases and other diseases. This can worsen many illnesses.

MESO does appear committed to the quality of its product. For MESO it is a question of the effectiveness and safety of their products. Its a long and winding road to provide adequate scientific proof when presenting breakthrough treatments to regulators. Many less reputable organizations have touted stem cells without doing the necessary scientific investigation or seeking the necessary regulatory approval. Mesoblast is trying to do things the right way. Committing to doing science the right way leads to a lot of inevitable ups and downs. This raises financial speculation and can lead to wild fluctuations in the stock price of any company.

A further significant advantage of some of Mesoblasts products is that they apparently can be administered to patients without needing donor matching. This increases their viability. Moreover, it allows for a wide spectrum of patients to be treated from their products. This gives them an advantage in comparison with other firms and should potentially allow them to increasingly gain a larger market share.

Of great interest to investors include the many clinical trial phase 3 products that Mesoblast has in its pipeline. These include MPC-06-ID, Remestemcel-L, and REVASCOR.

Remestemcel-L is a Mesoblast therapy that may theoretically have properties to help with the treatment of ventilator-dependent patients with COVID-19 patients. However, a clinical trial reported some concerns with the therapy meeting its primary endpoint. And it sent the stock down in December 2020. Obviously, there is a large demand for the treatment of complications linked to Covid-19, so this bad news disappointed investors.

However, another therapy has shown promise in the DREAM-HF Phase 3 for patients with chronic heart failure. Although the Revasacor did not stop heart failure, it did seem to deliver dramatic reductions in heart attacks and other negative cardiovascular events that plague heart failure patients.

Heart failure is a pathology that involves ones heart having trouble pumping. The condition impacts millions of people worldwide. In order to feed and maintain it working, the heart muscle depends on a continuous supply of oxygen rich blood. Having stem cell therapies is highly desirable to treat cardiovascular diseases. Hopefully, many Cardiovascular disorders can be treated with stem cell therapies in the future.

Other conditions such as hypertension and Coronary artery disease can help lead to heart failure. According to the Mayo Clinic, heart failure can cause significant health complications and lead to Liver and Kidney damage in patients.

Some scientists believe that Mesenchymal Stem Cells when used to treat cardiovascular diseases can preserve the myocardium by reducing the intensity of inflammation and supporting angiogenesis. Angiogenesis is a mechanism used by the body to create new blood vessels. Their low immunogenicity once more makes them a perfect treatment. This helps ensure that the immune system of the patient does not produce a negative response to the therapy. This theoretically can give stem cell therapies an advantage over some protein-based treatments that are easily recognized by the patients immune system.

This product could be a major development for Mesoblast moving forward, although further analysis and testing is still needed.

Stem cell therapies are not without experimental and medical challenges. For example, there are concerns with the ability of stem cell migration to tissues that require regeneration. There may also be cases whereby stem cells are divided into unintended cells. There may also be difficulties with the manufacturing and culturing of stem cells. Identification of Mesenchymal stem cells in cell populations can be problematic. From a scientific point of view, bone marrow derived Mesenchymal Stem Cells are known to be the best source for obtaining these cells in the human body.

Mesoblast has a wide range of advanced research programs related to different stem cell therapies. MPC-06-ID could potentially be a viable therapy for treating chronic low back pain attributable to degenerative disc disease.

These are products that consumers should be thrilled about.

The company has solid financials for a stem cell company and has a lot of cash on hand. The stock had a market cap of over 2 billion on 9/30/2020 and a 52-week high of 21.28. Lately the news surrounding the companys clinical trials has been a potpourri of both good and bad, so the share price has settled at around $9. It has a float of 93.7 million shares.

Mesoblast is a really exciting healthcare business. The business has made a commitment for the future. And it should be a stock that investors continue to follow.

Link:
Mesoblast Limited: Is Stemcell Therapy Ready For Prime Time? - Sick Economics

Bone Marrow Stem Cells Comments Off on Mesoblast Limited: Is Stemcell Therapy Ready For Prime Time? – Sick Economics | January 22nd, 2021

Introduction

Chronic myeloid leukemia (CML) is a hematological malignancy that develops when the 9;22 translocation in a single hematopoietic stem cell (HSC) results in the expression of BCR-ABL1 tyrosine kinase fusion protein. If left untreated, CML progresses over approximately 5 years, from relatively benign chronic phase to accelerated phase, and then to fatal blast crisis. The introduction of tyrosine kinase inhibitors (TKIs) specifically targeting the BCR-ABL1 fusion protein was a breakthrough in the management of CML, leading to a significant reduction in mortality and improved 5-year survival rates. However, despite the high annual acquisition costs of all the TKIs; first-, second-, and-third line TKIs1 induce only transient responses in the 10% to 15% of CML patients diagnosed in advanced phase, suboptimal responses in approximately 30% of CML patients during chronic phase (CP) cases that experience disease progression each year during, and only 1020% chance of successful treatment discontinuation due to disease persistence.2 Among the causes of disease persistence, studies have shown that CML leukemia stem cells (LSC) play a major role in inducing therapeutic resistance and disease progression because they are able to self-renew.3,4 These LSC a rare subset of immature cells residing in the bone marrow niche are protected from the action of TKI5 because these cells are normally quiescent and the TKIs are designed to target malignant blast cells that proliferate. That is why current strategies are not able to effectively eliminate the LSC or the disease.3 In CML, LSC are primitive cells expressing CD34+ CD38- with the 9;22 translocations, or the Philadelphia chromosome (Ph).6 However, these markers cannot distinguish the cancer hematopoietic cells from normal ones. Additionally, the BCR-ABL fusion gene encodes for an intracellular tyrosine kinase protein rather than a surface protein, calling for the need to identify unique surface biomarkers for efficient targeting of this cell population with subsequent eradication of the root of the disease.

In 2010, a single biomarker, Interleukin 1 receptor accessory protein (IL1RAP), was found to be up-regulated on the cell surface of BCR-ABL+ LSC. They were able to distinguish Ph+ from Ph- LSCs using IL1RAP.7 A polyclonal anti-human IL1RAP was generated that not only targeted the LSC population but also killed normal peripheral blood mononuclear cells, indicating that this marker was not specific to the LSC.7 Another characteristic cell surface marker has been investigated; ThomsenFriedenreich antigen (TF, or CD176) a tumor-associated carbohydrate epitope. The CD176 antigen was found to be expressed on the surface of various cancer-initiating cells, such as breast carcinomas,8 colorectal carcinomas,9 several leukemias,10 and other types of cancer, but was absent from almost all normal adult cell types.11 CD176 was also found to be expressed on the surface of CD34+ hematopoietic stem cells of the K562 erythroblastic leukemia cell line; a cell line derived from a CML patient. Being strongly expressed on the surface of cancer cells and virtually absent from normal tissues, CD176 was evaluated as a suitable target for cancer biotherapy8 with the development of an anti-CD176 antibody that induced apoptosis of leukemic cells.12

Using monoclonal antibodies (mAb) as a tool for cancer therapy still has its limitations. Patients who receive mAb therapy may develop drug resistance or fail to respond to treatment owing to the multiple signaling pathways involved in the pathogenesis of cancer and other diseases.13 Targeting more than one molecule has proven to circumvent the regulation of parallel pathways and avoid resistance to the treatment.14 Bi-specific antibodies (Bis-Ab) are antibodies that can recognize two different epitopes. They can redirect specific immune cells to the tumor cells to enhance tumor eradication, enable the simultaneous blocking of two different targets that have common signaling pathways, or interact with two different cell-surface antigens instead of one with subsequent boosting of the binding specificity.13 Thus, the identification of two surface markers specific to the cancer stem cells would be useful in characterizing and targeting CML stem cells, without affecting other blood cells.

In this study, we evaluated co-expression of IL1RAP, linked to BCR-ABL+ expression, and the CD176 antigen, carried on the hematopoietic stem cell marker CD34 molecule, in CML patients. We identified PBMCs co-expressing CD34, IL1RAP, and CD176 antigens using flow cytometry, a finding that allowed for subsequent separation and targeting of such cells from normal HSCs. A bi-specific antibody (TF/RAP), was generated in order to target the IL1RAP+ and CD176+ cell population among PBMCs in patients with CML. We used a flow-cytometry assay as a cell-based assay to measure the antibody binding capability of the TF/RAP Bis-Ab to the cell surface antigens. Our TF/RAP Bis-Ab, increased targeting of the IL1RAP+ and CD176+ cell population among CML PBMCs but not corresponding normal cells, using complement-dependent cytotoxicity assay (CDC). This novel TF/RAP Bis-Ab may provide a novel strategy for the eradication of CML stem cells.

Deidentified samples of peripheral blood from healthy volunteers were obtained from Gulf Coast Regional Blood Bank (Houston, TX, USA) after signing informed consent and used as reference samples. Deidentified samples of peripheral blood mononuclear cells (PBMCs) from consented patients with CML were obtained from Oncology Research Gundersen BioBank (https://www.gundersenhealth.org/research/biobank/, La Crosse, WI, USA). While the samples were de-identified, necessary CML patient characteristics were collected (Table 1). The collection and dissemination protocols for the samples are approved by The Gundersen Human Subjects Committee/Institutional Review Board (IRB) and are in full compliance with National Cancer Institute Best Practices for Biospecimen Resources. Because the de-identified samples were received through Biobanks and not through direct intervention/interaction with a research subject, the Tulane University Human Research Protection Office was notified and this study was classified by the IRB as exempt as the study did not meet the definition of human subjects research according to US Federal policy (HHS regulations, 45 CFR part 46, subpart A, also known as the Common Rule). The study was conducted in accordance with the Declaration of Helsinki.

Table 1 CML Patients Characteristics

HEK 293FT cell line (Invitrogen # R70007) was cultured in DMEM (Life Technologies, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, 100 g/mL streptomycin sulfate, and 4.0 mM L-glutamine (Gibco BRL products, Gaithersburg, MD), at 37C in a humidified 5% CO2 incubator. The KG1 cell line (ATCC #CCL-246) and transduced derivative cells were cultured in Iscoves Modified Dulbeccos Medium (Life technologies) supplemented with 20% FBS at 37C in a humidified 5% CO2 incubator. K562 cell line (ATCC# CCL-243) was maintained in RPMI-1640 (Life technologies) supplemented with 10% FBS, 100 U/mL penicillin, 100 g/mL streptomycin sulfate at 37C in a humidified 5% CO2 incubator.

The IL1RAP cDNA was PCR amplified from an expression plasmid containing Human IL-1RAcP/IL-1R3 Gene ORF cDNA (Sino biological Inc., HG10121-CM) using Clone Amp HiFi PCR Premix (Takara Bio USA, Inc.), and primers that included either a BamHI or an XhoI site (F-IL1RAP: acgggatccccaccaagcttggtaccatgac; R-IL1RAP: acgctcgagttatacatttttcaaagatg). The PCR fragment was gel extracted as above, sub-cloned into BamHI and XhoI sites in the pHRST-MPSV vector according to standard protocols and confirmed by restriction mapping and sequencing.

Transient production of lentiviral particles in adherent HEK293T was modified from previously described.15 Briefly, HEK293T cells were seeded in a T-75 flask, where we used 4.0 g of envelope plasmid pMPSV-VSV-G, 10.0 g packaging plasmid psPAX2, and 26 g transfer plasmid that has the gene of interest. In our case, the transfer plasmid is either the antibody plasmid or the control. The plasmids were mixed into 500 L 0.25 M CaCl2 (Sigma Aldrich, St. Louis, MO) and incubated at room temperature for 5 minutes, and then mixed with 500 L 2xHBS and briefly vortexed. The mixed transfection cocktail was then incubated for 3 minutes at room temperature, and added into the medium of the cells, and mixed gently to make an even distribution. After 16 hours of incubation, the medium was replaced with fresh medium and collected every 24 hours for 3 days. The conditioned medium that contained the vector virus was then pelleted for 10 minutes at 1500 g and passed through a 0.45-m filter to remove the cell debris, and then frozen at 80C for long-term storage, or used for the transduction of target cells.

Lentiviral transduction was done as previously described.1618 In brief, lentiviral supernatant was added to KG1 cells cultured in complete IMEM. After overnight incubation, the lentiviral vector was removed, and fresh media was added. After 48 hours, IL1RAP expression was demonstrated by flow cytometry using anti-Human IL-1 RAcP/IL-1 R3 PE-conjugated antibody (#FAB676P, R&D Systems, Minneapolis, MN).

The CH and CL constant domains in the pLM219 plasmids were amplified with 0.5 nM overlapping mutant primers (Table S1), Deep Vent Polymerase (New England Biolabs), and reaction buffer for forty cycles at 94C for 10 seconds, 60C for 45 seconds, and 72C for 2 minutes. Initial fragments were purified, combined, and used to amplify the entire heavy or light domains (Table S2). The mutated fragments were then gel purified and sub-cloned into their corresponding vectors using restriction enzymes according to standard protocols (Table S2). Sequences were then verified by restriction digestion and sequencing.

For antibody sequences towards CD176 (TF) and IL1RAP, the VH and VL domains from two clones with the most conserved amino acid sequences (TF Clone 1 and Clone 2 called TF1 and TF2 for CD176; Clone 4B6 and Clone 4G9 called RAPa and RAPb for IL1RAP, respectively) were chosen from published sequences.20,21 IL1RAP antibody was designed to target the extracellular membrane anchor-proximal region that comprises an amino acid primary sequence VPAPRYTVELAC within 10 to 15 amino acids of amino acid 361 of human ILR1AP (Gene bank accession Q9NPH3) while the TF antibody was designed to target the same Gal(13)GalNAc disaccharide epitope20 as the Bis-Ab. Variable domains (VD) were codon-optimized and synthesized (Gene Art, Invitrogen) to be compatible with 15 base pairs of homologous sequences on both the 3 and 5 ends of pLM2 recipient plasmid flanking the EcoRI restriction enzyme site.

The pLM2 expression vector was digested with EcoRI to generate a double-stranded break. An In-Fusion HD cloning kit (Clontech, Inc) was used to clone the VD regions of the antibodies between the leader and constant regions of the pLM2 vectors. The correct clones were identified by PCR and restriction mapping and then verified by sequencing.

Adherent HEK cells were transfected as above. A total of 14 g high-quality plasmid-DNA, 10% GFP plasmid for assessment of transfection efficiency, while the rest was heavy and light chain plasmid DNA combined at a ratio of 1:1. Six to 8 hours later, cells were gently washed once with PBS and fresh growth medium added. Sixteen hours post-transfection, the medium was replaced with DMEM supplemented with 5% FCS and incubated at 5% CO2 for 24 hours prior to the initial collection of antibody supernatant. A second collection was made after a further 24 hours.

Flow antibodies used were as follows: anti-TF/CD176 mAb mouse IgM (Glycotope, Berlin, Germany) targeting Gal1-3GalNAc epitope; FITC-conjugated anti-mouse IgM secondary antibody (-chain specific, #F9259; Sigma); PE-conjugated mouse anti-human IL-1 RAcP/IL-1 R3 monoclonal IgG1 antibody, epitope Ser21-Glu359 (#FAB676P, R&D Systems); APC-conjugated mouse anti-human CD34 monoclonal IgG1 antibody (#QBEnd10, FAB7227A-025, R&D Systems); APC-conjugated mouse antihuman IgG monoclonal antibody (Clone G18-145, mouse IgG1 , #550,931, BD Pharmingen).

LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (#L34957, Invitrogen); Vibrio Cholera Neuraminidase (VCN; Sigma Aldrich Inc), an enzyme used to expose the CD176 on the surface of expressing cells. Flow cytometric analyses were performed in a BD LSR Fortessa (BD Biosciences, USA) and flow cytometric cell sorting was done in a FACSAriaII (P0010) cell sorter (BD Biosciences, USA). The amount of bi-specific antibody bound to the receptors was calculated from the frequency of total IgG bound receptors.

Sorted cells were received in RPMI media and then fixed using the standard 3:1 methanol: acetic acid fixative. Standard procedures were used for FISH hybridization and washing.22 The BCR/ABL1 Plus translocation, dual fusion probe set (Cytocell Inc., Tarrytown, NY) was used. Slides were analyzed using Leica Biosystems Cyto Vision. FISH nomenclature was described according to the ISCN 2016.23

CD34+CD176+IL1RAP+ and CD34+CD176+IL1RAP- cells were sorted from PBMC samples derived from patients with CML. Cells (1 x 103) were plated in Metho Cult Express (#04437, Stem Cell Technologies, Vancouver, Canada) semi-solid media containing recombinant human IL-3, IL-6, G-CSF, GM-CSF, SCF, TPO and cultured for 2 weeks in a humidified atmosphere at 37C with 5% CO2. Fourteen days after plating, the number of colonies was counted by microscopy.24,25

The capacity to induce CDC was assessed essentially as has been described.2628 Briefly, target cells (1105 cells) were pre-incubated at 37C for 60 min with diluted antibodies. Human serum from human male AB (Sigma Aldrich) (20% v/v) was added to the cells as a source of complement and incubated at 37C for an additional 45 min. Cells were then put on ice and viability was determined by staining with LIVE/DEAD staining and detected using a FORTESSA flow cytometer (BD Biosciences). CDC activity was expressed as a percentage of lyses as determined from the increase in the percentage of cells stained positive with the LIVE/DEAD marker compared to the control samples. Cycloviolacin O2 (CyO2, 0.05nM), a pore-forming peptide, was used as a positive control because it kills cells with the similar mechanisms as CDC by causing pores in the cell membrane.

The capacity to induce CDC was assessed essentially as has been described.2628 Briefly, target cells (1105 cells) were pre-incubated at 37C for 60 min with diluted antibodies. Human serum from human male AB (Sigma Aldrich) (20% (v/v)) was added to the cells as a source of complement and incubated at 37C for an additional 45 min. Cells were then put on ice and viability was determined by staining with LIVE/DEAD staining and detected using a FORTESSA flow cytometer (BD Biosciences). CDC activity was expressed as a percentage of lyses as determined from the increase in the percentage of cells stained positive with the LIVE/DEAD marker compared to the control samples. Cycloviolacin O2 (CyO2, 0.05nM), a pore-forming peptide, was used as a positive control because it kills cells with the similar mechanisms as CDC by causing pores in the cell membrane.

We measured the production of the Bis-Ab by ELISA. Plates were initially coated with goat anti-Human IgG heavy chain antibody (Axell) and blocked with PBS containing 0.5% Tween 20 (Fisher), 10% FBS (FetalPlex Animal Serum Complex, GeminiBio, Cat#100-602), 4% whey protein (BiPRO, AGROPUR). Undiluted or diluted supernatant was added, including the standard curve samples (human IgG MAb 1.7B, kindly provided by Dr. James Robinson), and negative blocking buffer. After incubating at 37C for 60 min, the plates were washed. Then, goat anti-Human lambda antibody conjugated to HRP (Southern Biotech, Cat# 207005) was added at 1:300 in blocking buffer for 60 min and washed five times. A mixture of 0.1M Na Acetate (pH 6), peroxide, and TMB substrate were added. The reaction was terminated by adding 1M phosphoric acid, and the absorbance of each well was measured at 450 nm using a Synergy H1 microplate reader (BioTek).

For each experiment, more than three independent replicates were conducted, and the results were expressed as average standard deviation. Comparison of multiple groups was conducted using ANOVA-based Test and p< 0.05 (*) represented significances with statistical meaning. Calculation of the Kd was done using the equation % RO = [Ab]/([Ab]+Kd) 100%, where RO is the receptor occupancy, Ab is the concentration of antibody and Kd is the equilibrium dissociation constant.

In order to analyze the co-expression of CD176 and IL1RAP antigens on CD34+ cells, peripheral blood mononuclear cells from a normal volunteer (NPBMCs), patients with CML, and K562 cells were isolated and stained with anti-CD34, anti-CD176, and anti-IL1RAP monoclonal antibodies and analyzed by flow cytometry (Figure 1A). It has been previously established that these markers were not expressed on normal PBMCs nor on stem cells7,10 CD34+ cell expression ranged from an average 938% in CML samples versus 83.7% in K562 cells (Figure 1A, upper panel). Within the CD34+ cell population, CD176 and IL1RAP antigens were variably expressed in CML samples, ranging from 1.35% in CML-4 to over 50% in CML-1 (Figure 1A, lower panel), while CD176+ IL1RAP+ was detected in 78% of CD34 cells in K562 cells. Surprisingly, surface co-expression of CD176 and IL1RAP was not only detectable on CD34+ cells in patients with BCR-ABL positive CML but was also demonstrable in cells from a treated patient who was BCR-ABL negative (CML-2) (Figure 1B). In Figure 1C, CD34+ cells revealed higher frequency of CD176+ IL1RAP+ in CML group compared to control sample (17.5% versus 3.4%, p<0.001).

Figure 1 CD176 and IL1RAP antigens are co-expressed on CD34+ Leukemia stem cells. Peripheral blood mononuclear cells from patients with CML and healthy volunteers were isolated and stained for flow-cytometry analysis. (A) FACS Dot Blot showing expression of CD34 (top row) and co-expression of CD176 and IL1RAP antigens on the CD34+ cells (bottom row) in PBMCs from patients with CML compared to NPBMCs. (B) Bar graphs showing the BCR-ABL status relative to the percentage of IL1RAP and CD176 co-expression in the CD34+ subsets from patients with CML as compared to the normal control and the positive control (K562 cells). The BCR-ABL status is indicated below the sample. The error bars represent the variation in two independent experiments. (C) Average percentage of CD34+ and CD34+ CD176+ IL1RAP+ subsets in normal versus CML patients respectively. (D) Bar graphs showing the average count of colony-forming units (CFU) per 1000 CD34+CD176+IL1RAP- cells (open bar) or CD34+CD176+IL1RAP+ cells (solid bar) obtained from CML-2 and CML-4 samples. **p< 0.01, n.s represents that there is no significant difference between groups.

In order to analyze the progenitor activity of the various subpopulations, CML-2 and CML-4 were flow-sorted for CD34+CD176+IL1RAP+ and CD34+CD176+IL1RAP- then plated in media t support hematopoietic colony formation. The number of colonies, or colony-forming units (CFU), in CD34+CD176+IL1RAP+ pool represented 6% of the sorted cells with a significant difference between both populations, p<0.01 (Figure 1D and Figure S1).

To facilitate correct interaction of the VH and VL domains, site-directed mutagenesis was used to generate knob-in-hole mutations in the heavy and light chains of the constant domains (Figure 2A) via polymerase chain reaction overlap extension (Figures S2 and 3). Two PCR reactions were performed to generate two amplicons with the specific mutations included in the overlapping primers. The two fragments were then combined in a subsequent fusion reaction, in which the overlapping ends anneal, allowing the 3 overlap of each strand to serve as a primer for the 3 extension of the complementary strand. The resulting fusion product served as a template for amplification of the entire constant domain. In order to circumvent the light chain mismatching, an Orthogonal Fab interface was generated. In one Fab, complementary mutation was introduced and verified at the heavy chain constant domain (CH1_H172A_ F174G) and at the light chain constant domain (CL_L135Y_S176W), respectively (Figures S46). For the heavy chain heterodimerization, we used the Knob-in-Hole strategy, where we inserted the CH3 mutations (S354C and T366W) into different heavy chains (Figures S7 and 8). The VH and VL sequences were synthesized and cloned into the new pLM2-CH and -CL plasmids (Figure 2A) where CD176 was represented by TF1 (VH1 and VL1) and TF2 (VH2 and VL2) while IL1RAP was represented by Clone 4B6 (VHa and VLa) and Clone 4G9 (VHb and VLb). Then, we generated the four different bi-specific antibody mixtures (TF1RAPa, TF1RAPb, TF2RAPa, and TF2RAPb) to evaluate the most effective Bis-Ab (Figure 2B). The bispecific antibody was quantified by ELISA at 283 ng/mL. Since ELISA used the human IgG heavy chain antibody as the primary antibody and a goat anti-human lambda antibody conjugated to HRP as the secondary antibody, these data also confirm the correct association of the heavy and light chains and ensure that monomers are excluded.

Figure 2 The bi-specific antibody arms. (A) Schematic diagram of the bi-specific antibody showing the mutant arms and the antigen-binding domains. Thomsen-Freidenrich or CD176 domains (TF); IL1RAP domains (RAP); variable domain-heavy chain (VH); variable domain-light chain (VL); L135Y and S176W mutations (Y-W) in constant domain-light chain; H172A and F174G mutations in CH1 domain (A-G); S354C (C) or T366W (W) mutations in CH3. (B) Antibody mixtures generated by transient transfection of HEK 293T cells. TF1 and TF2 was paired with RAPa and RAPb to generate four Bis-Ab mixtures. The bispecific antibody concentration was 283 ng/mL as measured with ELISA. The correct association of the human IgG heavy chain and the lambda light chain was confirm and monomers were excluded by using anti-IgG primary antibodies and anti-light chain secondary antibodies.

KG1 cell line is an acute myeloid leukemia cell line that is known to be a positive control for CD176. For optimizing the staining protocol of CD176, KG1 cells were pre-treated with VCN to expose CD176 antigens for better staining (Figure S9). In order to test the binding capability and functional potential of our bi-specific antibody, we generated a dual-positive cell line for expressing both IL1RAP and CD176 through lentiviral transduction (Figure S10A and B). IL1RAP expression was increased by 1.5 folds in KG1/RAP cells as verified by flow cytometry (Figure S10C and D).

CD176 antigen is a glycosylated antigen; a protein antigen bound to GAL-NAC moiety which makes the antigen displayed on the cell surface yet not easy to isolate.21 For this reason, a flow-cytometry assay was used to evaluate both the binding capability and toxicity of our Bis-Ab using the gating strategy in Figure S11. KG1 and KG1/RAP cell lines were treated with the various Bis-Ab mixtures. Binding percentage was calculated from the percentage of IgG positive cells, where the secondary IgG antibody is bound to the primary Bis-Ab. The TF1RAPa Bis-Ab showed the highest binding in KG1/RAP cells (Figure 3A) as compared to other mixtures (p<0.001). In contrast, the TF1RAPb antibody revealed slightly reduced binding in KG1/RAP cells. On treating KG1/RAP cells with increasing amounts of TF1RAPa, more binding to the dual-positive KG1/RAP cells was observed (Figure 3B). To demonstrate the specificity of the Bis-Ab, we measured the competition with the CD176 and the IL1RAP monoclonal antibodies. Increasing concentrations of the Bis-Ab specifically inhibited the binding of both the IL1RAP and CD176 mAbs (Figure S12). Then, our KG1/RAP cells were treated with the Bis-Ab TF1RAPa and complement prior to staining with the LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, in order to evaluate whether CDC could be achieved using IL1RAP and CD176 as targets. Flow cytometric analysis revealed a significant increase in dead cells in the Bis-Ab treated CD176/IL1RAP dual-positive KG1/RAP population as antibody binding also increased (Figure 3C), p<0.001.

Figure 3 Validation of TF-RAP Bi-specific antibody in KG1 cell line and CML samples. (A) MFI for binding of different Bis-Ab mixtures in KG1/RAP (p <0.001). (B) Binding (%) of the Bis-Ab in KG1/RAP cell lines. (C) Shows live/dead (LD) staining (%) in KG1/RAP cell lines after treatment with the Bis-Ab and complement. (D) MFI for binding of different Bis-Ab mixtures p <0.001 in CML cells. (E) Binding of the Bis-Ab (%) in PBMCs from patients with CML. The binding affinity (Kd) of our bispecific antibody was 21ng/mL, calculated using the % RO = [Ab]/([Ab]+Kd) 100%, where RO is the receptor occupancy, Ab is the concentration of antibody, and Kd is the equilibrium dissociation constant. This Bis-Ab platform used in this study had the correct molecular weight (95 KDa) and assembled properly (93%) as revealed by SDS-PAGE analysis.38 (F) Live/dead (L/D) staining (%) from patients with CML after treatment with the Bis-Ab and complement. The red square were L/D positive cells treated with CyO2; the percent of L/D staining in normal PBMCs is shown in blue. Each point represents the mean increase in L/D staining SEM with three to four replicates. Data from normal samples were low for all doses (data not shown).

Binding of TF1RAPa, TF2RAPa, and TF2RAPb was also tested in PBMCs from patients with CML. Again, TF1RAPa showed the highest binding relative to other mixtures (p<0.001) (Figure 3D) and with increasing doses (Figure 3E). Based on the CML binding curve, the binding affinity (Kd) of our bispecific antibody was 21 ng/mL. Other therapeutic antibodies, such as ofatumumab directed against CD20, have shown significant CDC against peripheral blood cells obtained from CML patients in chronic phases26 and B cells in CLL,29 respectively. Thus, the TF1RAPa cocktail was used to generate the doseresponse curve and to evaluate whether CDC could be achieved using both IL1RAP and CD176 as targets. The ability of the TF1RAPa cocktail was compared to human anti-IL1RAP and anti-CD176 monoclonal antibodies to induce cell death in PBMCs from patients with CML. PBMCs from CML1-4 were tested in CDC assays in parallel to cells from healthy control samples. In CML cells, the binding of TF1RAPa mediated CDC at higher levels than in normal peripheral blood mononuclear control cells, correlating with the expression level of IL1RAP and CD176, particularly at lower antibody concentrations (Figure 3F). More strikingly, among peripheral blood cells, TF1RAPa did not induce CDC of normal cells, whereas a clear dose-dependent CDC effect was observed in CML cells (Figure S13A and B). To address the selectivity of IL1RAP/CD176-targeting antibodies, we also validated the bispecific antibody cytotoxicity on the various subpopulations in peripheral blood. The dual-positive CD176+IL1RAP+ cell populations showed the highest CDC activity as compared to CD176+IL1RAP-, CD176-IL1RAP+, and CD176-IL1RAP- populations (Figure 4 and S13CF, S14).

Figure 4 Dose-response curve of TF1RAPa Bis-Ab on CDC in CML samples. A dose-response curve showing the selective killing potential of CD176+IL1RAP+ subpopulation by the TF1RAPa Bis-Ab as compared to other subpopulations in PBMCs from patients with CML. Each point represents the mean SEM of the four samples.

Targeting molecules involved in multiple pathways is proving to be one of the most reliable strategies for eradicating cancer stem cells. In this report, we present a novel bi-specific antibody, TF/RAP, capable of targeting ThomsenFriedenreich (TF, CD176) and IL1RAP antigens on CD34+ HSCs in CML and on cell lines. TF is a glycoprotein that has many domains and motifs (eg, LGALS3, Gal(1,3)GalNAc, LGalS3BP), many related to signaling pathways. It is a known marker for ongoing tumorigenesis and metastasis, as it is expressed on various cancer-initiating cells.8 Interestingly, CD34 and LGALS3 were found to be co-expressed in myeloid cells.30,31 LGALS3 and ABL1 are involved in regulating RUNX1 and the transcription of genes involved in differentiation of hematopoietic stem cells,32 especially myeloid cells33 (Figure S15) IL1RAP, on the other hand, is a member of the Toll-like receptor superfamily and is a well-known co-receptor of IL1R1.34 IL1RAP plays a role in mediating the effect of the pro-inflammatory cytokine IL-1 and is also involved in activating T cells and mast cells after mediating the signal of IL-1 cytokine.35 It has previously been characterized as a tightly related marker for BCR-ABL positive cells.7 Together, both TF and IL1RAP were related to apoptotic pathways; IL1RAP up-regulation was associated with decreased apoptosis in AML,36 and anti-CD176 antibody induced apoptosis of CD176-positive leukemic cells through multiple pathways.12 Although we did not find a direct link between IL1RAP, CD176 and leukemogenesis, previous studies have shown that each of them is separately expressed on CD34+ cells in leukemia cell lines8,10,12 and patients with CML7

Therefore, we conducted this pilot study, in order to assess the co-expression of IL1RAP and ThomsenFriedenreich (CD176) antigens on CD34+ HSCs in peripheral blood of patients with CML, using FACS gene expression analyses. Flow-drop FISH and CFU assays were used for the separation of CD34+CD176 BCR-ABL+ and BCR-ABL CML stem cells, based on IL1RAP expression.7 CFU numbers were significantly lower in CD34+CD176+IL1RAP- cells than in CD34+CD176+IL1RAP+ cells, obtained from CML-2 and CML-4 samples (Figure 1D), particularly CML-2 sample which was obtained from a patient in remission (BCR-ABL-). We found that the frequency of clonogenic hematopoietic progenitor cells was increased in the CD34+ CD176+IL1RAP+ cells in these samples. Testing the stem-cell characteristics of these two cell populations in immune-deficient mice would have been advantageous. Yet, the low numbers of sorted CML cells acquired from the CD34+CD176+ IL1RAP and IL1RAP+ cell subpopulations, alongwith the general low engrafting efficiency of chronic phase CML cells in these mice7 prevented us from successfully performing such experiments. Importantly, as IL1RAP expression was correlated with changes from chronic phase (CP) into accelerated phase (AP) and blast phase (BP)37, we also found that the level of IL1RAP/CD176 co-expressionwas increased, in our patient samples, as the disease progressed, independent of the treatment status(Table S3).

To target both TF and IL1RAP simultaneously, we developed a Bis-Ab specific for both antigens. Because antibodies are normally heterodimers of two heavy and two light chains, we modified the constant domains in the Bis-Ab to maximize the correct interactions of the four immunoglobulin chains within single cells. Here, we used the orthogonal Fab design; CH1_H172A_F174G and CL_L135Y_S176W38 to facilitate selective assembly of the Fab arms for correct dimerization of the antigen-binding domains.39 Therefore, we mutated CH1 and CL binding sites to restrict the assembly of the Fab with the correct VD pairs. The RAP VDs were cloned with the wild type Fab; and the TF VD was linked to the mutant orthogonal Fab design. Published data have shown that the component proteins of this Bis-Ab platform proper assembly were detected at 93% and the complex had a molecular weight of 95 KDa, as revealed by SDS-PAGE analysis.38 Additionally, the CH3 for each Fab was mutated with previously described knob-into-hole mutations40,41 to facilitate hetero-dimerization between the TF and the RAP heavy chains. In our study, we used ELISA to demonstrate that both the VD and Fc were properly paired. Here, because the primary antibody was anti-human VL and the secondary antibody was anti-human IgG, quantifying the Bis-Ab also demonstrated the VD-Fc interactions.

To efficiently validate the specific binding of our Bis-Ab, we generated a dual-positive cell line; KG1/RAP. KG1 cell line expresses CD176+, but IL1RAP is low or absent. Therefore, we induced IL1RAP expression in KG1 cells by lentiviral mediated-gene transfer, as previously usedin both immune42 and leukemic cells.43 In the competitive binding assay, increasing concentrations of the Bis-Ab blocked the binding of CD176 and IL1-RAP monoclonal antibodies to the KG1/RAP and KG1 parental cells, demonstrating the specific binding of the Bis-Ab. The level of CD176 expression in KG1 cell line was detected before and after VCN treatment. Increased staining of the KG1/RAP cells compared to the parental KG1 cells indicated that expression of the IL1RAP facilitates the interaction of the Bis-Ab with the target cell. This increased binding of the Bis-Ab to the KG1/RAP cells also increased their susceptibility to complement-dependent cytotoxicity (CDC). We also observed increased binding and increased CDC in the CD176+ IL1RAP+ population of the peripheralblood from patients with CML. As a pilot study and given that on average, 50% of the cells within the CD34+ subpopulation in the patients tested were dual positive for CD176 and IL1RAP antigens, in addition to the almost undetectable CDC in CD34+ cells in normal controls, our data strongly support the idea that the bi-specific antibody (TF/RAP) indeed induces CDC preferentially in CD176+ IL1RAP+ CML CD34+ cells. In generating a bi-specific antibody that targets CD176 and IL1RAP, we are unique in providing proof of concept that CML CD34+CD176+ IL1RAP+ cells can be targeted while preserving corresponding normal cells. The potential to target multiple antigens is supported by studies that demonstrated increased or synergistic CDC activity by non-cross blocking CD20 antibody combinations.44

Therapeutic antibodies are commonly administered intravenously, yet selectivity and specificity are a major concern for reduced toxicity. CD176/IL1RAP co-expression was not present in monocytes unlike the reported weak but present IL1RAP expression in monocytes.7 Both antigens were low or absent in most types of normal bone-marrow progenitor and mature cell types, suggesting that CD176/IL1RAP dual targeting antibodies are expected to show low toxicity on normal hematopoietic cells. Being strongly expressed on the surface of cancer cells and virtually absent from normal tissues, CD176 was evaluated as a potential target for cancer biotherapy with the development of anti-CD176 antibody that induced apoptosis of leukemic cells.8 Added to this, antibodies against IL1RAP were found to be capable of blocking IL-1 signaling as well as inhibiting tumor cells' growth in AML,34 CML,7 breast cancer,45 prostate cancer, breast cancer, lung cancer, colorectal cancer, melanomas, bladder cancer, brain/CNS cancer, cervical cancer, esophageal cancer, gastric cancer, head/neck cancer, kidney cancer, liver cancer, lymphomas, ovarian cancer, pancreatic cancer, and sarcomas46 especially in cancer stem cells, or (CSCs) and progenitor cells, which are responsible, directly or indirectly, for the development of a solid tumor.47 Thus, it may be thatour Bis-Ab will not only eradicate the CD176+IL1RAP+ drug-resistantCML stem cells but also may have universal therapeutic potential for preventing relapses in both solid and hematological cancers.Given that the mode of action in CDC is having the antibody direct the complement pathway to target cell killing, we suggest that this therapeutic strategy would be independent of known mechanisms of TKI resistance in CML. Thus, the concept of complement-mediated killing of IL1RAP/CD176 expressing cells may also have the potential to eradicate such cells in patients, either alone or in combination with current regimens, in order to increase their therapeutic effectiveness. And finally, expanded studies need to be performed in order to confirm the co-expression of both markers, especially in resistant and relapsed cancer patients as well as in patient-derived xenografts (PDX).

The experimental research was mostly supported by a fellowship to REE from the Egyptian Ministry of Higher Education, Cultural, and Missions Section (JS 3577). The lentiviral vectorHRST-cmvGFPand the packaging plasmids were akind gift from Richard C.Mulligan in the Harvard Gene Therapy Institute. The human IgG heavy and light chain constant genes were provided by JE Robinson (Tulane University). C Wu and SEB were supported by AI110158 and/or OD01104-51; EUA and SEB were supported by the Applied Stem Cell Laboratory.

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work. All authors have given approval of the final version of the article; and have agreed to be accountable for all aspects of the work.

The abstract of this paper was presented at the AACR annual Meeting 2019; March 29 April3, 2019; Atlanta, GA, as a poster presentation with interim findings. The posters abstract was published in Poster Abstracts in the AACR meeting proceedings and as a supplement in the AACR Cancer Research Journal [https://cancerres.aacrjournals.org/content/79/13_Supplement/1222A].

Raghda Eldesouki reports grants from Egyptian Ministry of Higher Education. Stephen EBraun reports grants from Egyptian Ministry of Education, Alliance for Cardiovascular Research, NIAID OD01104, and Braun/McGroarty Charitable Fund, during the conduct of the study. In addition, Dr Raghda Eldesouki, Dr Stephen Braun, Dr Fouad Badr and Dr Eman Abdel-Moemen Mohammedhave apatent, PCT/EG2019/000014, pending. The authors report no other conflicts of interest in this work.

1. Marchetti M. Cost-effectiveness of kinase inhibitors for hematologic malignancies: a systematic and critical review. Expert Rev Pharmacoecon Outcomes Res. 2017;17(5):469480. doi:10.1080/14737167.2017.1366858

2. Holyoake TL, Helgason GV. Do we need more drugs for chronic myeloid leukemia? Immunol Rev. 2015;263(1):106123.

3. Zhou H, Xu R. Leukemia stem cells: the root of chronic myeloid leukemia. Protein Cell. 2015;6(6):403412.

4. Holyoake TL, Vetrie D. The chronic myeloid leukemia stem cell: stemming the tide of persistence. Blood. 2017;129(12):15951606. doi:10.1182/blood-2016-09-696013

5. Koptyra M, Falinski R, Nowicki MO, et al. BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance. Blood. 2006;108(1):319327. doi:10.1182/blood-2005-07-2815

6. Tasian SK, Bornhuser M, Rutella S. Targeting leukemia stem cells in the bone marrow niche. Biomedicines. 2018;6(1):22. doi:10.3390/biomedicines6010022

7. Jrs M, Johnels P, Hansen N, et al. Isolation and killing of candidate chronic myeloid leukemia stem cells by antibody targeting of IL-1 receptor accessory protein. Proc Natl Acad Sci U S A. 2010;107(37):1628016285. doi:10.1073/pnas.1004408107

8. Goletz S, Cao Y, Danielczyk A, Ravn P, Schoeber U, Karsten U. Thomsen-Friedenreich antigen: the hidden tumor antigen. Adv Exp Med Biol. 2003;535:147162.

9. Kurtenkov O, Innos K, Sergejev B, Klaamas K. The Thomsen-Friedenreich antigen-specific antibody signatures in patients with breast cancer. Bio Med Res Int. 2018;2018:9579828.

10. Sindrewicz P, Lian LY, Yu LG. Interaction of the onco-fetal Thomsen-Friedenreich antigen with galectins in cancer progression and metastasis. Front Oncol. 2016;6:79. doi:10.3389/fonc.2016.00079

11. Lin WM, Karsten U, Goletz S, Cheng RC, Cao Y. Expression of CD176 (Thomsen-Friedenreich antigen) on lung, breast, and liver cancer-initiating cells. Int J Exp Pathol. 2011;92(2):97105. doi:10.1111/j.1365-2613.2010.00747.x

12. Yi B, Zhang M, Schwartz-Albiez R, Cao Y. Mechanisms of the apoptosis induced by CD176 antibody in human leukemic cells. Int J Oncol. 2011;38:15651573.

13. Fan G, Wang Z, Hao M, Li J. Bi-specific antibodies and their applications. J Hematol Oncol. 2015;8:130. doi:10.1186/s13045-015-0227-0

14. Varela MA. Identification of sequences common to more than one therapeutic target to treat complex diseases: simulating the high variance in sequence interactivity evolved to modulate robust phenotypes. BMC Genom. 2015;16(1):530. doi:10.1186/s12864-015-1727-6

15. Wu C, Lu Y. High-titre retroviral vector system for efficient gene delivery into human and mouse cells of hematopoietic and lymphocytic lineages. J Gen Virol. 2010;91(8):19091918. doi:10.1099/vir.0.020255-0

16. Ge D, Zhang QS, Zabaleta J, et al. Doublecortin may play a role in defining chondrocyte phenotype. Int J Mol Sci. 2014;15(4):69416960. doi:10.3390/ijms15046941

17. Braun SE, Wong FE, Connole M, et al. Inhibition of simian/human immunodeficiency virus replication in CD4+ T cells derived from lentiviral-transduced CD34+ hematopoietic cells. Mol Ther. 2005;12(6):11571167. doi:10.1016/j.ymthe.2005.07.698

18. Braun SE, Lu XV, Wong FE, et al. Potent inhibition of simian immunodeficiency virus (SIV) replication by an SIV-based lentiviral vector expressing antisense Env. Hum Gene Ther. 2007;18(7):653664. doi:10.1089/hum.2007.003

19. Robinson JE, Hastie KM, Cross RW, et al. Most neutralizing human monoclonal antibodies target novel epitopes requiring both Lassa virus glycoprotein subunits. Nat Commun. 2016;7:11544. doi:10.1038/ncomms11544

20. Goltez S, Karasten U Cancer stem cell markers and uses thereof. WIPO, WO2011089004A1 2011 Jul 28.

21. Jiang Y, Tso J, Karsunky H. Antibodies that bind membrane-bound IL1rap. European patent EP2935334A1. 2015 Oct 28.

22. Keaglen MB, Gersen SL. Basic cytogenetics laboratory procedures. In: Gersen SL, Keagle MB, editors. The Principles of Clinical Cytogenetics. NewYork, NY: Springer NewYork; 2013:5365.

23. International Standing Committee on Human Cytogenetic Nomenclature. ISCN2016: An International System for Human Cytogenetic Nomenclature. Karger Medical and Scientific Publishers; 2016.

24. Broxmeyer HE, Etienne-Julan M, Gotoh A, et al. Hematopoietic colony formation from human growth factor-dependent TF1 cells and human cord blood myeloid progenitor cells depends on SHP2 phosphatase function. Stem Cells Dev. 2013;22(6):9981006. doi:10.1089/scd.2012.0478

25. Balduini A, Broxmeyer HE, Braun SE, Cornetta K, Lyman S. Comparative effects of retroviral mediated gene transfer into primary human stromal cells of flt3ligand, interleukin 3 and gmcsf on production of cord blood progenitor cells in longterm culture. Stem Cells. 1998;16:3749. doi:10.1002/stem.5530160807

26. Tatake RJ, Maniar HS, Chiplunkar SV, et al. Antibody-dependent cellular cytotoxicity and complement-mediated cytotoxicity on leukemic cells mediated by anti K562 monoclonal antibodies. J Clin Lab Immunol. 1990;31(2):8791.

27. Lindorfer MA, Beum PV, Taylor RP. CD20 mAb-mediated complement dependent cytotoxicity of tumor cells is enhanced by blocking the action of factor I. Antibodies. 2013;2:598616. doi:10.3390/antib2040598

28. Gerlach SL, Chander PK, Roy U, et al. The membrane-active phytopeptide. Cycloviolacin O2 simultaneously targets HIV1-infected cells and infectious viral particles to potentiate the efficacy of antiretroviral drugs. Medicines (Basel). 2019;6(1):E33. doi:10.3390/medicines6010033

29. Zen CS, Secreto CR, LaPlant BR, et al. Direct and complement dependent cytotoxicity in CLL cells from patients with high-risk early-intermediate stage chronic lymphocytic leukemia (CLL) treated with alemtuzumab and rituximab. Leuk Res. 2008;32(12):18491856. doi:10.1016/j.leukres.2008.05.014

30. Marer N. Galectin3 expression in differentiating human myeloid cells. Cell Biol Int. 2000;24:245251. doi:10.1006/cbir.1999.0501

31. Labbaye C, Testa U. The emerging role of MIR-146A in the control of hematopoiesis, immune function and cancer. J Hematol Oncol. 2012;5:13. doi:10.1186/1756-8722-5-13

32. Huang H, Woo AJ, Waldon Z, et al. A Src family kinase-Shp2 axis controls RUNX1 activity in megakaryocyte and T-lymphocyte differentiation. Genes Dev. 2012;26(14):15871601. doi:10.1101/gad.192054.112

33. Zhang HY, Jin L, Stilling GA, et al. RUNX1 and RUNX2 upregulate Galectin-3 expression in human pituitary tumors. Endocrine. 2009;35(1):101111. doi:10.1007/s12020-008-9129-z

34. gerstam H, Karlsson C, Hansen N, et al. Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia. Proc Natl Acad Sci U S A. 2015;112(34):1078610791.

35. McEntee CP, Finlay CM, Lavelle EC. Divergent roles for the IL-1 family in gastrointestinal homeostasis and inflammation. Front Immunol. 2019;10:1266.

36. Barreyro L, Will B, Bartholdy B, et al. Over expression of IL-1 receptor accessory protein in stem and progenitor cells and outcome correlation in AML and MDS. Blood. 2012;120(6):12901298. doi:10.1182/blood-2012-01-404699

37. Zhao K, Yin LL, Zhao DM, et al. IL1RAP as a surface marker for leukemia stem cells is related to a clinical phase of chronic myeloid leukemia patients. Int J Clin Exp Med. 2014;7(12):47874798.

38. Lewis SM, Wu X, Pustilnik A, et al. Generation of bi-specific IgG antibodies by structure-based design of an orthogonal Fab interface. Nat Biotechnol. 2014;32:191198. doi:10.1038/nbt.2797

39. Spidel JL, Vaessen B, Chan YY, Grasso LJ, Kline B. Rapid high-throughput cloning and stable expression of antibodies in HEK293 cells. J Immunol Methods. 2016;439:5058. doi:10.1016/j.jim.2016.09.007

40. Ridgway JB, Presta LG, Carter P. Knobs-into-holes engineering of antibody CH3 domains for heavy chain heterodimerization. Protein Eng. 1996;9:617621. doi:10.1093/protein/9.7.617

41. Atwell S, Ridgway JB, Wells JA, Carter P. Stable heterodimers from remodeling the domain interface of a homodimer using a phage display library. J Mol Biol. 1997;270:2635. doi:10.1006/jmbi.1997.1116

42. Pan H, Mostoslavsky G, Eruslanov E, Kotton DN, Kramnik I. Dual-promoter lentiviral system allows inducible expression of noxious proteins in macrophages. J Immunol Methods. 2007;329(12):3144. doi:10.1016/j.jim.2007.09.009

43. Biagi E, Bambacioni F, Gaipa G, et al. Efficient lentiviral transduction of primary human acute myelogenous and lymphoblastic leukemia cells. Haematologica. 2001;86(1):1316.

44. Melis JP, Strumane K, Ruuls SR, Beurskens FJ, Schuurman J, Parren PW. Complement in therapy and disease: regulating the complement system with antibody-based therapeutics. Mol Immunol. 2015;67:117130. doi:10.1016/j.molimm.2015.01.028

45. Liberg D, nnervik P, Riva M, Larsson L, Forsberg G, Wachenfeldt K. Antibody Blockade of IL1RAP Signaling Reduces Metastasis in a Breast Cancer Model. Annual Meeting of the American Association for Cancer: McCormick Place North/South Chicago, Illinois, USA; 2018.

46. Fioretos T, Jaras M Method of treatment of a solid tumor with interleukin-1 accessory protein antibody. United States patent US 9403906B2. 2016 Aug 02.

47. Fioretos T, Jaras M. Anti - IL1rap antibodies and their use for treating human. European patent EP2665749A1. 2013 Nov 27.

Originally posted here:
[Full text] Identification and Targeting of ThomsenFriedenreich and IL1RAP | OTT - Dove Medical Press

Bone Marrow Stem Cells Comments Off on [Full text] Identification and Targeting of ThomsenFriedenreich and IL1RAP | OTT – Dove Medical Press | January 22nd, 2021

NEW YORK, Jan. 20, 2021 /PRNewswire/ --BrainStorm Cell Therapeutics Inc. (NASDAQ: BCLI), a leading developer of adult stem cell therapies for neurodegenerative diseases, announced today the peer-reviewed publication of a preclinical study in the journal Stem Cell and Research Therapy. The study, entitled "MSC-NTF (NurOwn) exosomes: a novel therapeutic modality in the mouse LPS-induced ARDS model," evaluated the use of NurOwn (MSC-NTF cell) derived exosomes in a mouse model of acute respiratory distress syndrome (ARDS).

ARDS is a type of respiratory failure that is frequently associated with COVID-19 and mediated by dysregulated cytokine production. While there are currently no effective therapies to prevent or reverse ARDS, mesenchymal stem cell (MSC)-derived exosomes have been suggested as a potential novel treatment option due to their ability to penetrate deep into tissues and efficiently deliver immunomodulatory molecules.

Results from the recently published study showed that intratracheal administration of NurOwn derived exosomes led to a statistically significant reduction in lung disease severity score (p < 0.05; based on criteria set forth by the American Thoracic Society Documents: Matute-Bello et al., Am J Respir Cell Mol Biol 44;725-738, 2011) and improvements in several additional clinically relevant lipopolysaccharide (LPS)-induced ARDS markers such as lung function, fibrin presence, neutrophil accumulation, cytokine expression, and blood oxygenation levels. Notably, these improvements were significantly superior to those observed following administration of nave MSC-derived exosomes.

"These exciting preclinical data suggest that NurOwn derived exosomes have the potential to treat COVID-19-induced ARDS or other severe respiratory complications, and that they are more effective than exosomes isolated from nave MSCs at combatting the various symptoms of the syndrome," said Dr. Revital Aricha, Vice President of Research & Development at BrainStorm. "This publication in a highly regarded journal provides important validation for the scientific advances and significance of BrainStorm's preclinical research programs, including on our exosome-based technology platform."

Chaim Lebovits, Brainstorm's Chief Executive Officer added, "While our primary focus is on advancing NurOwn towards regulatory approval in ALS, we continue to evaluate the potential of our exosome-based platform to address unmet medical needs. The publication of these proof-of-concept data highlights this potential, and we are now actively assessing next steps to determine how to best generate value. We are also actively discussing with possible partners several development opportunities for the exosome technology."

About NurOwn

The NurOwn technology platform (autologous MSC-NTF cells) represents a promising investigational therapeutic approach to targeting disease pathways important in neurodegenerative disorders. MSC-NTF cells are produced from autologous, bone marrow-derived mesenchymal stem cells (MSCs) that have been expanded and differentiated ex vivo. MSCs are converted into MSC-NTF cells by growing them under patented conditions that induce the cells to secrete high levels of neurotrophic factors (NTFs). Autologous MSC-NTF cells can effectively deliver multiple NTFs and immunomodulatory cytokines directly to the site of damage to elicit a desired biological effect and ultimately slow or stabilize disease progression.

About BrainStorm Cell Therapeutics Inc.

BrainStorm Cell Therapeutics Inc. is a leading developer of innovative autologous adult stem cell therapeutics for debilitating neurodegenerative diseases. The Company holds the rights to clinical development and commercialization of the NurOwn technology platform used to produce autologous MSC-NTF cells through an exclusive, worldwide licensing agreement. Autologous MSC-NTF cells have received Orphan Drug status designation from the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) for the treatment of amyotrophic lateral sclerosis (ALS). BrainStorm has completed a phase 3 pivotal trial in ALS (NCT03280056); this trial investigated the safety and efficacy of repeat-administration of autologous MSC-NTF cells and was supported by a grant from the California Institute for Regenerative Medicine (CIRM CLIN2-0989). BrainStorm is in active discussions with the FDA to identify regulatory pathways that may support NurOwn's approval in ALS. BrainStorm is also conducting an FDA-approved phase 2 open-label multicenter trial in progressive multiple sclerosis (MS). The phase 2 study of autologous MSC-NTF cells in patients with progressive MS (NCT03799718) completed dosing inDecember 2020, and topline results are expected by the end of the first quarter 2021.

For more information, visit the company's website atwww.brainstorm-cell.com.

Safe-Harbor Statement

Statements in this announcement other than historical data and information, including statements regarding future clinical trial enrollment and data, constitute "forward-looking statements" and involve risks and uncertainties that could cause BrainStorm Cell Therapeutics Inc.'s actual results to differ materially from those stated or implied by such forward-looking statements. Terms and phrases such as "may," "should," "would," "could," "will," "expect,""likely," "believe," "plan," "estimate," "predict," "potential," and similar terms and phrases are intended to identify these forward-looking statements. The potential risks and uncertainties include, without limitation, BrainStorm's need to raise additional capital, BrainStorm's ability to continue as a going concern, regulatory approval of BrainStorm's NurOwn treatment candidate, the success of BrainStorm's product development programs and research, regulatory and personnel issues, development of a global market for our services, the ability to secure and maintain research institutions to conduct our clinical trials, the ability to generate significant revenue, the ability of BrainStorm's NurOwn treatment candidate to achieve broad acceptance as a treatment option for ALS or other neurodegenerative diseases, BrainStorm's ability to manufacture and commercialize the NurOwn treatment candidate, obtaining patents that provide meaningful protection, competition and market developments, BrainStorm's ability to protect our intellectual property from infringement by third parties, heath reform legislation, demand for our services, currency exchange rates and product liability claims and litigation; and other factors detailed in BrainStorm's annual report on Form 10-K and quarterly reports on Form 10-Q available athttp://www.sec.gov. These factors should be considered carefully, and readers should not place undue reliance on BrainStorm's forward-looking statements. The forward-looking statements contained in this press release are based on the beliefs, expectations and opinions of management as of the date of this press release. We do not assume any obligation to update forward-looking statements to reflect actual results or assumptions if circumstances or management's beliefs, expectations or opinions should change, unless otherwise required by law. Although we believe that the expectations reflected in the forward-looking statements are reasonable, we cannot guarantee future results, levels of activity, performance or achievements.

Logo - https://mma.prnewswire.com/media/1166536/BrainStorm_Logo.jpg

CONTACTS

Investor Relations:Corey Davis, Ph.D.LifeSci Advisors, LLCPhone: +1-646-465-1138[emailprotected]

Media:Paul TyahlaSmithSolvePhone: +1-973-713-3768[emailprotected]

SOURCE Brainstorm Cell Therapeutics Inc

Home

Read the original:
BrainStorm Announces the Publication of Preclinical Data Highlighting the Potential of a NurOwn Derived Exosome-Based Treatment for COVID-19 ARDS -...

Bone Marrow Stem Cells Comments Off on BrainStorm Announces the Publication of Preclinical Data Highlighting the Potential of a NurOwn Derived Exosome-Based Treatment for COVID-19 ARDS -… | January 22nd, 2021