Page 26«..1020..25262728..4050..»

Covid-19 leads to shortage of bone marrow donors – GO! and Express

By daniellenierenberg

The SA Bone Marrow Registry (SABMR) says their ability to recruit new donors has been severely limited by the outbreak of the second Covid-19 wave.

SABMR head of donor recruitment Nadia Chalkley said they typically recruit a few hundred new donors each year from the Eastern Cape.

The shrinking pool of donors has had a material impact on our ability to match patients suffering from life threatening blood diseases with suitable donors, she said.

At any given time, there are more than 200 patients in SA that need a bone marrow transplant. The fewer donors we have, the lesser the chance of finding a match. For patients with leukemia, thalassemia and other blood disorders, a bone marrow transplant is their only hope of survival.

Chalkley said the the current odds of finding a successful match is about one in 100,000 and will only get worse as the donor pool continues to shrink.

Sadly, more than 70% of patients struggle to find a stem cell match within their own families, which means many rely on strangers for a second chance at life.

If local donors are not forthcoming, we have to look overseas for potential matches, which is costly.

She said SABMR was working hard to ensure the safety of donors and patients by allowing online registration.

We also offer at-home sampling kits, which only requires a cheek swab. These kits can be delivered and collected free of charge from anywhere in the country.

Once new donors have completed the online registration form, they will be contacted by one of our consultants to discuss the easiest way of dispatching and collecting the kits.

One of the biggest misconceptions with regards to bone marrow donation, according to Chalkley, is that it involves large needles being pushed into ones spine.

However, the most common form of donation is whats called peripheral blood stem cell collection, since the same blood-forming cells found in bone marrow are also present in circulating blood.

The process is similar to donating plasma and doesnt require surgery.

In order to register as a bone marrow donor, you must be between the ages of 16 and 45 and meet the required standards listed by the SABMR.

A full list of the criteria can be found at https://sabmr.co.za/.

Each of us have a role to play. This new year, put away frivolous resolutions and rather direct your energy into making a difference by signing up as a donor. The simple act could just make someones new years wish come true, Chalkley said.

Visit the SABMR website, call 021-447-8638 or email donors@sabmr.co.za

Related

Read this article:
Covid-19 leads to shortage of bone marrow donors - GO! and Express

To Read More: Covid-19 leads to shortage of bone marrow donors – GO! and Express
categoriaBone Marrow Stem Cells commentoComments Off on Covid-19 leads to shortage of bone marrow donors – GO! and Express | dataJanuary 31st, 2021
Read All

What Is Leukemia: And How To Prevent It? – Technology Times Pakistan

By daniellenierenberg

Leukemia is the cancer of blood cells, usually white blood cells which fight and clears infections. It is also known as cancer of blood-forming tissues i.e lymphatic system and bone marrow. It is usually characterized by greatly increased numbers of abnormal white blood cells in circulating blood. It is a very serious disorder and the patient needs to change the blood regularly with normal blood from donors.

By Aysha Bibi

How does leukemia develop?

Our blood contains many different types of cells. These include red blood cells, white blood cells, and platelets. These cells are made on daily basis in the bone marrow. Leukemia happens when the body starts making white blood cells beyond its need. Immature white blood cells are released in the blood and these are non-functional. Moreover, as white blood cells increase in number, the number of red blood cells and platelets are not enough to maintain a healthy life and perform their normal functions.

Types of Leukemia

Leukemia has four main types

In the acute form of leukemia, cells multiply quickly in the bone marrow and enter the circulatory system too early but these cells are immature and non-functional. Chronic leukemia occurs when marrow produces mature cells and it progresses more slowly than other forms.

Lymphocytic leukemia is a type with an accumulation of apparently mature dysfunctional lymphocytes. Normally lymphocytes differentiate to form B-cells, T-cells, and natural killer cells which are the backbone of the immune system.

Myelogenous leukemia is a cancer of white blood cells usually granulocytes and monocytes. Either it is lymphocytic or myeloid, leukemia results in a compromised immune system, and the body cannot protect itself from different infections.

Acute lymphocytic leukemia(ALL) It is most common in children. It can spread to the central nervous system.

Acute myelogenous leukemia(AML) It is the second most common type of leukemia in children and also common in adults.

Chronic lymphocytic leukemia It is common in adults. This remains stable for many years but in some types, patients need treatment.

Chronic myelogenous leukemia(CML) Older people may are at higher risk for this type of leukemia.

Risk Factors

Some significant risk factors that can cause leukemia

Symptoms of Leukemia

Various types of leukemia can cause different symptoms. These symptoms usually not appear in the early stages, but they may include;

Diagnosis of Leukemia

CBC: with a blood test doctor looks at several different blood cells and their maturity. Immature cells may appear in the blood.

Bone marrow biopsy is done by taking bone marrow. With help of this doctor check the type and severity of leukemia.

CT scan and MRI are also done for the diagnosis of leukemia.

Treatment of Leukemia

Depending on the type of leukemia and its spreading, a doctor may look for the following options:

In a radiation treatment, high energy X-rays are used to kill leukemic cells. But normal cells are also affected.

In chemotherapy, different drugs are given to kill leukemic cells in blood and bone marrow. This may include a pill or injection in muscle or vein.

Targeted therapy is done to block the expression of some genes or proteins that are involved in the production of cancerous cells.

A Stem cell transplant involves a bone marrow transplant from a healthy donor. In this method, high-dose chemotherapy is done to destroy the leukemic cells of a patient. The healthy stems cells of donor are then injected to body.

Splenectomy is the removal of spleen and doctor may look for this option if spleen becomes fills with cancer cell and start affecting other body organs.

Preventing or reducing the risk of leukemia

Unfortunately, there is currently no cure for leukemia. Minimum exposure to pesticides and radiations may help to reduce the risk of leukemia. Leukemia can also be prevented by avoiding tobacco.

One can lower the risk of developing leukemia by following:

It is the best way to lower the risk of leukemia.

Studies have shown that overweight and obesity are also contributing factors to increasing the risk of developing leukemia.

Pollution, gasoline, car exhaust contains low levels of benzene. It is also found in offices and homes and found in paint, glue, etc. wearing a mask while using these may help you lower the risk of exposure.

Medical radiations like x-rays increase the risk of leukemia. Try to avoid unnecessary radiation exposure.

Your body and mind function at their best with a healthy diet. Proper nutrition provides energy fuel for body functioning, it also strengthens the immune system.

References:

Read the original post:
What Is Leukemia: And How To Prevent It? - Technology Times Pakistan

To Read More: What Is Leukemia: And How To Prevent It? – Technology Times Pakistan
categoriaBone Marrow Stem Cells commentoComments Off on What Is Leukemia: And How To Prevent It? – Technology Times Pakistan | dataJanuary 31st, 2021
Read All

Stem Cell Therapy Market 2021: Global Key Players, Trends, Share, Industry Size, Segmentation, Forecast To 2027 KSU | The Sentinel Newspaper – KSU |…

By daniellenierenberg

Stem Cell Therapy Market is valued at USD 9.32 Billion in 2018 and expected to reach USD 16.51 Billion by 2025 with the CAGR of 8.5% over the forecast period.

Rising prevalence of chronic diseases, increasing spend on research & development and increasing collaboration between industry and academia driving the growth of stem cell therapy market.

Scope of Stem Cell Therapy Market-

Stem cells therapy also known as regenerative medicine therapy, stem-cell therapy is the use of stem cells to prevent or treat the condition or disease. Stem cell are the special type of cells those differentiated from other type of cell into two defining characteristics including the ability to differentiate into a specialized adult cell type and perpetual self-renewal. Under the appropriate conditions in the body or a laboratory stem cells are capable to build every tissue called daughter cells in the human body; hence these cells have great potential for future therapeutic uses in tissue regeneration and repair. Among stem cell pluripotent are the type of cell that can become any cell in the adult body, and multipotent type of cell are restricted to becoming a more limited population of cells.

Get Sample of This Report@ https://brandessenceresearch.com/requestSample/PostId/1246

The stem cell therapy has been used to treat people with conditions including leukemia and lymphoma, however this is the only form of stem-cell therapy which is widely practiced. Prochymal are another stem-cell therapy was conditionally approved in Canada in 2012 for the treatment of acute graft-vs-host disease in children those are not responding to steroids. Nevertheless, hematopoietic stem cell transplantation is the only established therapy using stem cells. This therapy involves the bone marrow transplantation.

Stem cell therapy market report is segmented based on type, therapeutic application, cell source and by regional & country level. Based upon type, stem cell therapy market is classified into allogeneic stem cell therapy market and autologous market.

Stem Cell Therapy Companies:

Stem cell therapy market report covers prominent players like,

Based upon therapeutic application, stem cell therapy market is classified into musculoskeletal disorders, wounds and injuries, cardiovascular diseases, surgeries, gastrointestinal diseases and other applications. Based upon cell source, stem cell therapy market is classified into adipose tissue-derived mesenchymal stem cells, bone marrow-derived mesenchymal stem cells, cord blood/embryonic stem cells and other cell sources

The regions covered in this stem cell therapy market report are North America, Europe, Asia-Pacific and Rest of the World. On the basis of country level, market of stem cell therapy is sub divided into U.S., Mexico, Canada, U.K., France, Germany, Italy, China, Japan, India, South East Asia, GCC, Africa, etc.

Stem Cell Therapy Market Segmentation

By Type

Allogeneic Stem Cell Therapy Market, By Application

Autologous Market, By Application

By Therapeutic Application

By Cell Source

Stem Cell Therapy Market Dynamics

Rising spend on research and development activities in the research institutes and biotech industries driving the growth of the stem cell therapy market during the forecast period. For instance, in January 2010, U. S. based Augusta University initiated Phase I clinical trial to evaluate the safety and effectiveness of a single, autologous cord blood stem infusion for treatment of cerebral palsy in children. The study is estimated to complete in July 2020. Additionally, increasing prevalence of chronic diseases creating the demand of stem cell therapy. For instance, as per the international diabetes federation, in 2019, around 463 million population across the world were living with diabetes; by 2045 it is expected to rise around 700 million. Among all 79% of population with diabetes were living in low- and middle-income countries. These all factors are fuelling the growth of market over the forecast period. On the other flip, probabilities of getting success is less in the therapeutics by stem cell may restrain the growth of market. Nevertheless, Advancement of technologies and government initiative to encourage research in stem cell therapy expected to create lucrative opportunity in stem cell therapy market over the forecast period.

Stem Cell Therapy Market Regional Analysis

North America is dominating the stem cell therapy market due increasing adoption rate of novel stem cell therapies fueling the growth of market in the region. Additionally, favorable government initiatives have encouraging the regional market growth. For instance, government of Canada has initiated Strategic Innovation Fund Program, in which gov will invests in research activities carried out for stem cell therapies. In addition, good reimbursing scheme in the region helping patient to spend more on health. Above mentioned factors are expected to drive the North America over the forecast period.

Full Research Report @ https://brandessenceresearch.com/healthcare/stem-cell-therapy-market-size

About us: Brandessence Market Research and Consulting Pvt. Ltd.

Brandessence market research publishes market research reports & business insights produced by highly qualified and experienced industry analysts. Our research reports are available in a wide range of industry verticals including aviation, food & beverage, healthcare, ICT, Construction, Chemicals, and lot more. Brand Essence Market Research report will be best fit for senior executives, business development managers, marketing managers, consultants, CEOs, CIOs, COOs, and Directors, governments, agencies, organizations, and Ph.D. Students. We have a delivery center in Pune, India and our sales office is in London.

Contact usat: +44-2038074155 ormail usatsales@brandessenceresearch.com

Website: https://brandessenceresearch.com/

Article: https://businessstatsnews.com

Blog: https://technologyindustrynews.com

Blog: https://marketstatsreport.com

Blog: https://industrywatchnews.com/

Read more:
Stem Cell Therapy Market 2021: Global Key Players, Trends, Share, Industry Size, Segmentation, Forecast To 2027 KSU | The Sentinel Newspaper - KSU |...

To Read More: Stem Cell Therapy Market 2021: Global Key Players, Trends, Share, Industry Size, Segmentation, Forecast To 2027 KSU | The Sentinel Newspaper – KSU |…
categoriaBone Marrow Stem Cells commentoComments Off on Stem Cell Therapy Market 2021: Global Key Players, Trends, Share, Industry Size, Segmentation, Forecast To 2027 KSU | The Sentinel Newspaper – KSU |… | dataJanuary 29th, 2021
Read All

UTV documentary tells of young Belfast woman’s lasting legacy to promote stem cell donation – The Irish News

By daniellenierenberg

EIMEAR Gooderham (ne Smyth) was just 25 when she died peacefully in hospital with her family at her bedside.

It was just a week after she had married Phillip Gooderham in hospital and she was buried in the wedding dress she never got to wear.

Almost two years on, her family hope a television documentary about Eimear - a make-up artist from the Coolnasilla area of west Belfast - will help create a positive and lasting legacy in her memory.

The programme, due to be broadcast on UTV and presented by journalist Sarah Clarke, features Eimear's own video diaries, which she had hoped would raise awareness of a campaign for stem cell donors that she launched before her death.

Ms Clarke said the documentary had aimed to "follow Eimear's journey, treatment and her recovery".

"She was very open about her battle and while a lot of the programme is distressing, it shows how courageous Eimear was," she said.

Eimear was diagnosed with stage two Hodgkins Lymphoma, a type of blood cancer, in September 2016.

She underwent 12 cycles of intensive chemotherapy and was given the all-clear in spring 2017.

But the disease returned and in December that year, Eimear was treated with an autologous stem cell transplant, intensive chemotherapy and her own stem cells returned afterwards to rescue her bone marrow from the effect of the treatment.

Months later she was given the good news she was in remission, but the Hodgkins Lymphoma returned again and doctors said her best chance of survival was another stem cell transplant - this time from a donor.

With neither of her siblings a match, she desperately needed to find a stem cell donor.

Eimear and her father Sean launched an appeal to raise awareness of the stem cell register, which allows donors of the correct tissue types to be matched with patients.

Their campaign saw the number of people joining the register in Northern Ireland soar.

Determined to use her own experience to help others, Eimear began filming videos on her phone for the UTV documentary.

Her desire to show her cancer battle as well as her upbeat outlook on life are reflected in the diaries, with many filmed as she underwent treatment.

Speaking ahead of the broadcast tonight, Ms Clarke said her own family's cancer battle had also inspired her to tell Eimear's story.

"In 2017, my nephew Jack was diagnosed with leukaemia, aged just 15," she said.

"I remember my brother Simon, who is a doctor, saying they may have to pursue a stem cell transplant. He knew how difficult it would be to find a match and to endure.

"Fortunately Jack didn't need it, but he had to undergo a year of intensive chemo and four years of maintenance chemo.

"It was rough and a very difficult period and thankfully he's now in remission, but it made me relate to Eimear and San's appeal."

On October 31 2018 - a year before Eimear and Phillip had planned to marry - she received her stem cell transplant.

A video extract of the days after the operation shows Eimear describe how "it's been really rough", as the donor's cells began attacking her cells - a condition known as graft versus host disease.

Despite being discharged from hospital, months later she became ill again with complications associated with the transplant - she was losing her brave battle.

Phillip tells the programme: "I wanted to tell her it was going to be ok, but I didn't want to lie to her. I wanted it to be over so she wasn't in pain".

In June 2019, the couple tied the knot and Eimear got "her final wish".

"We had had it planned, we had to cancel our wedding so it was, in the most horrific circumstances, the nicest way to end her life, by her getting her final wish," said Phillip.

Eimear died on June 27 2019.

Since then her family have continued to campaign to raise awareness of stem cell donation.

Her father Sean said they hope the programme will "highlight the need for more people in Northern Ireland to join the stem cell donor register, especially young men aged between 16 and 30".

Sarah also said while the documentary is "not exactly the one we set out to make, its still one of hope and courage".

"It was Eimears dying wish to raise awareness of stem cell donation and to help further research into the treatment to help others," she said.

"She was adamant she wanted people to sign the register and raise awareness. Her family feel the onus is now on them to continue this.

"The programme pays tribute to a courageous young woman and her family's desire to create a positive and lasting legacy in her memory."

Up Close: Eimears Wish is on UTV at 10.45pm.

Read more:
UTV documentary tells of young Belfast woman's lasting legacy to promote stem cell donation - The Irish News

To Read More: UTV documentary tells of young Belfast woman’s lasting legacy to promote stem cell donation – The Irish News
categoriaBone Marrow Stem Cells commentoComments Off on UTV documentary tells of young Belfast woman’s lasting legacy to promote stem cell donation – The Irish News | dataJanuary 29th, 2021
Read All

BrainStorm-Cell Therapeutics to Announce Fourth Quarter and Fiscal Year 2020 Financial Results and Provide a Corporate Update – Yahoo Finance

By daniellenierenberg

NEW YORK, Jan. 28, 2021 /PRNewswire/ --BrainStorm-Cell Therapeutics Inc. (NASDAQ: BCLI), a leader in developing innovative autologous cellular therapies for highly debilitating neurodegenerative diseases, announced today that the Company will hold a conference call to update shareholders on financial results for the fourth quarter and year ended December 31, 2020, and provide a corporate update, at 8:00 a.m., Eastern Time, on Thursday, February 4, 2020.

BrainStorm's CEO, Chaim Lebovits, will present a corporate update, after which, participant questions will be answered. Joining Mr. Lebovits to answer investment community questions will be Ralph Kern, MD, MHSc, President and Chief Medical Officer, Stacy Lindborg, PhD, Executive Vice President and Global Head of Clinical Research ,David Setboun, PharmD, MBA, Executive Vice President and Chief Operating Officer, Preetam Shah, PhD, MBA, Executive Vice President and Chief Financial Officer.

Participants are encouraged to submit their questions prior to the call by sending them to: q@brainstorm-cell.com. Questions should be submitted by 5:00 p.m. EDT, Wednesday, February 3, 2020.

The investment community may participate in the conference call by dialing the following numbers:

Participant Numbers:

Toll Free: 877-407-9205

International: 201-689-8054

Webcast URL: https://cutt.ly/vjBvkTp

Those interested in listening to the conference call live via the internet may do so by visiting the "Investors & Media" page of BrainStorm's website at http://www.ir.brainstorm-cell.com and clicking on the conference call link.

Those that wish to listen to the replay of the conference call can do so by dialing the numbers below. The replay will be available for 14 days.

Replay Number:

Toll Free: 877-481-4010

International: 919-882-2331

Replay Passcode: 39495

About NurOwn

The NurOwn technology platform (autologous MSC-NTF cells) represents a promising investigational therapeutic approach to targeting disease pathways important in neurodegenerative disorders. MSC-NTF cells are produced from autologous, bone marrow-derived mesenchymal stem cells (MSCs) that have been expanded and differentiated ex vivo. MSCs are converted into MSC-NTF cells by growing them under patented conditions that induce the cells to secrete high levels of neurotrophic factors (NTFs). Autologous MSC-NTF cells can effectively deliver multiple NTFs and immunomodulatory cytokines directly to the site of damage to elicit a desired biological effect and ultimately slow or stabilize disease progression.

Story continues

About BrainStorm Cell Therapeutics Inc.

BrainStorm Cell Therapeutics Inc. is a leading developer of innovative autologous adult stem cell therapeutics for debilitating neurodegenerative diseases. The Company holds the rights to clinical development and commercialization of the NurOwn technology platform used to produce autologous MSC-NTF cells through an exclusive, worldwide licensing agreement. Autologous MSC-NTF cells have received Orphan Drug status designation from the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) for the treatment of amyotrophic lateral sclerosis (ALS). BrainStorm has completed a phase 3 pivotal trial in ALS (NCT03280056); this trial investigated the safety and efficacy of repeat-administration of autologous MSC-NTF cells and was supported by a grant from the California Institute for Regenerative Medicine (CIRM CLIN2-0989). BrainStorm is in active discussions with the FDA to identify regulatory pathways that may support NurOwn's approval in ALS. BrainStorm is also conducting an FDA-approved phase 2 open-label multicenter trial in progressive multiple sclerosis (MS). The phase 2 study of autologous MSC-NTF cells in patients with progressive MS (NCT03799718) completed dosing in December 2020, and topline results are expected by the end of the first quarter 2021.

For more information, visit the company's website at http://www.brainstorm-cell.com.

ContactsInvestor Relations:Corey Davis, Ph.D.LifeSci Advisors, LLCPhone: +1 646-465-1138cdavis@lifesciadvisors.com

Media:Paul TyahlaSmithSolvePhone: + 1.973.713.3768Paul.tyahla@smithsolve.com

View original content:http://www.prnewswire.com/news-releases/brainstorm-cell-therapeutics-to-announce-fourth-quarter-and-fiscal-year-2020-financial-results-and-provide-a-corporate-update-301217243.html

SOURCE Brainstorm Cell Therapeutics Inc

Continued here:
BrainStorm-Cell Therapeutics to Announce Fourth Quarter and Fiscal Year 2020 Financial Results and Provide a Corporate Update - Yahoo Finance

To Read More: BrainStorm-Cell Therapeutics to Announce Fourth Quarter and Fiscal Year 2020 Financial Results and Provide a Corporate Update – Yahoo Finance
categoriaBone Marrow Stem Cells commentoComments Off on BrainStorm-Cell Therapeutics to Announce Fourth Quarter and Fiscal Year 2020 Financial Results and Provide a Corporate Update – Yahoo Finance | dataJanuary 29th, 2021
Read All

National Institute for Health and Care Excellence (NICE) recommends lenalidomide as a maintenance therapy for people with newly diagnosed multiple mye…

By daniellenierenberg

National Institute for Health and Care Excellence (NICE) recommends lenalidomide as a maintenance therapy for people with newly diagnosed multiple myeloma who have undergone a stem cell transplant

Uxbridge, UK, 27th January 2021: Celgene, a Bristol Myers Squibb (BMS) company, today announces that NICE has issued a Final Appraisal Document (FAD) recommending REVLIMID (lenalidomide) as maintenance treatment after an ASCT for newly diagnosed multiple myeloma in adults.[iv] From today, approximately 1150 eligible patients in England will have immediate access to lenalidomide as a treatment option, with interim funding provided via the Cancer Drugs Fund (CDF) before transferring to baseline commissioning. Lenalidomide is the first treatment to be made available on the NHS in this setting and provides an alternative to the standard watch-and-wait approach, allowing patients to receive active treatment to keep their cancer in remission.

Graham Jackson, Professor of Clinical Haematology at Newcastle Upon Tyne NHS Foundation Trust said: Multiple myeloma is a relapsing remitting disease where the goal of treatment is to ensure long periods of remission and a good quality of life. Maintenance therapy is integral to achieving this, particularly for newly diagnosed patients who have received a stem cell transplant. Having lenalidomide within our treatment armoury on the NHS will transform the way we manage the early stages of multiple myeloma. In clinical studies maintenance therapy has been shown to almost double the initial period of remission for this group of patients, so it is fantastic to be able to offer active treatment which can help to keep the cancer at bay.

Multiple myeloma is a cancer that affects the production of plasma cells in the bone marrow and in turn impacts the bodys immune system.[v] It is characterised by a relapsing-remitting pattern, which means that the disease goes through periods where the cancer is active and needs treatment, followed by periods where it is under control.[vi] Each time the cancer relapses, the length of time spent in remission shortens.[vii] The objective of maintenance therapy is to control the cancer during the period of remission and delay relapse of the disease.[viii]

Laura Kerby, Chief Executive of Myeloma UK said: We are delighted with this outcome. Patients who receive lenalidomide maintenance after high-dose therapy and stem cell transplant have a significant increase in overall survival, so the decision to make this available through the NHS is fantastic news.

Across the UK, around 1,500 newly diagnosed multiple myeloma patients undergo an ASCT each year,1,2 and most of them will eventually relapse.[ix] This first remission is a critical period for people with multiple myeloma, as it can be an indicator of the overall survival of the disease and it has been shown that effective maintenance therapy could be essential to long-term survival.[x]

Lynelle Hoch, General Manager at Bristol Myers Squibb UK & Ireland commented: Todays announcement marks an important milestone for those living with multiple myeloma, with lenalidomide being the first maintenance treatment option to be made accessible to eligible patients in England. We are grateful for the continued collaboration with NICE, healthcare professionals and Myeloma UK to ensure patients can benefit from lenalidomide in this setting.

Following the publication of this guidance, the NHS in Wales is expected to provide funding and resources for lenalidomide in this setting within two months. The treatment is already available on the NHS in Scotland and in Northern Ireland.[xi],[xii]

See original here:
National Institute for Health and Care Excellence (NICE) recommends lenalidomide as a maintenance therapy for people with newly diagnosed multiple mye...

To Read More: National Institute for Health and Care Excellence (NICE) recommends lenalidomide as a maintenance therapy for people with newly diagnosed multiple mye…
categoriaBone Marrow Stem Cells commentoComments Off on National Institute for Health and Care Excellence (NICE) recommends lenalidomide as a maintenance therapy for people with newly diagnosed multiple mye… | dataJanuary 29th, 2021
Read All

Every day is a success for little boy with leukaemia after life-saving transplant – Grimsby Live

By daniellenierenberg

'Every day that passes is a huge success' for the parents of a little boy who has received a life-saving stem cell transplant.

Zakk Galvin battled leukaemia for 18 months, but after his chemotherapy treatment stopped being effective, his parents were forced to appeal for a stem cell donor.

He has been offered a new lease of life after the transplant has gone ahead.

The six-year-old from Winterton is currently in a fragile condition recovering from the transplant in hospital.

It took months of searching to find a matching donor for Zakk odds that his parents compared to one in a million.

To sign up for the Grimsby Live newsletter, click here.

Zakk has been staying in Sheffield Childrens Hospital since the process began on Boxing Day. It could be months until he can return home, but his parents are thankful for each day.

Dad Craig said: The first week was spent preparing Zakk to receive the cord blood transplant which involved a significant amount of chemotherapy and total body irradiation therapy.

The purpose of this was to totally eliminate any remaining cancer from his body, as well as dampen his body's natural instinct to fight anything invading.

This made Zakk very poorly, and indeed we had some of our hardest days and nights since his journey began in March 2019.

Along with this was the fragility that comes with such treatment, as his immune system and own body defences must be completely overcome in order for the grafted stem cells to not be rejected.

Zakk, who lives in Winterton, has acute lymphoblastic leukaemia, a rare form in which the bone marrow produces faulty white blood cells.

On January 4, he received the healthy stem cells which can take over.

Bone marrow is the tissue inside of bones.

It's a 'factory' which it essential to the human body, as it produces all the required blood cells.

However, it can stop working properly due to diseases like leukemia.

In these cases, the best hope is a transplant from someone with healthy bone marrow.

The actual transplant itself went ahead relatively anti-climactically, Craig said.

You would think that this monumental occasion would involve a huge theatre surgery or some fantastical machine, when in actual fact it is an IV infusion over within about 45 minutes.

But God is in the detail because what was being infused was the stem cells which would hopefully implant and give Zakk new life.

The young boy is now undergoing a vigorous schedule of daily tests and scans to monitor his health.

Due to his fragile condition, he isnt able to see his mum Elizabeth or sisters Annabelle and Eshter, who are eagerly waiting for his return home.

He is very tired, very irritable and suffering from any number of unpleasant symptoms, but we pray that through this trial a miracle is happening just waiting to break through, Craig said.

We know, and most importantly he knows, that it will be a rollercoaster ride, that tonight maybe totally different from today, tomorrow a stark contrast to yesterday.

"But still we look to the day when he will be able to leave hospital and come home to see his sisters, mother and cats.

He's too fragile to be able to see them until that time. We don't know at this time when that will be, his birthday is in late March - it would be wonderful for him to have it at home!

As his transplant consultant has said, Every day that passes is a huge success so we must thank the Lord for every day.

To help other people in urgent need of a donor, you can join the British Bone Marrow Registry or register with the DKMS .

Excerpt from:
Every day is a success for little boy with leukaemia after life-saving transplant - Grimsby Live

To Read More: Every day is a success for little boy with leukaemia after life-saving transplant – Grimsby Live
categoriaBone Marrow Stem Cells commentoComments Off on Every day is a success for little boy with leukaemia after life-saving transplant – Grimsby Live | dataJanuary 27th, 2021
Read All

If I Have Cancer, Dementia or MS, Should I Get the Covid Vaccine? – Kaiser Health News

By daniellenierenberg

As public demand grows for limited supplies of covid-19 vaccines, questions remain about the vaccines appropriateness for older adults with various illnesses. Among them are cancer patients receiving active treatment, dementia patients near the end of their lives and people with autoimmune conditions.

Recently, a number of readers have asked me whether older relatives with these conditions should be immunized. This is a matter for medical experts, and I solicited advice from several. All strongly suggested that people with questions contact their doctors and discuss their individual medical circumstances.

Experts advice may be helpful since states are beginning to offer vaccines to adults over age 65, 70 or 75, including those with serious underlying medical conditions. Twenty-eight states are doing so, according to the latest survey by The New York Times.

Q: My 80-year-old mother has chronic lymphocytic leukemia. For weeks, her oncologist would not tell her yes or no about the vaccine. After much pressure, he finally responded: It wont work for you, your immune system is too compromised to make antibodies. She asked if she can take the vaccine anyway, just in case it might offer a little protection, and he told her he was done discussing it with her.

First, some basics. Older adults, in general, responded extremely well to the two covid-19 vaccines that have received special authorization from the Food and Drug Administration. In large clinical trials sponsored by drugmakers Pfizer and Moderna, the vaccines achieved substantial protection against significant illness, with efficacy for older adults ranging from 87% to 94%.

But people 65 and older undergoing cancer treatment were not included in these studies. As a result, its not known what degree of protection they might derive.

Dr. Tobias Hohl, chief of the infectious diseases service at Memorial Sloan Kettering Cancer Center in New York City, suggested that three factors should influence patients decisions: Are vaccines safe, will they be effective, and what is my risk of becoming severely ill from covid-19? Regarding risk, he noted that older adults are the people most likely to become severely ill and perish from covid, accounting for about 80% of deaths to date a compelling argument for vaccination.

Regarding safety, there is no evidence at this time that cancer patients are more likely to experience side effects from the Pfizer-BioNTech and Moderna vaccines than other people. Generally, we are confident that these vaccines are safe for [cancer] patients, including older patients, said Dr. Armin Shahrokni, a Memorial Sloan Kettering geriatrician and oncologist.

The exception, which applies to everyone, not just cancer patients: people who are allergic to covid-19 vaccine components or who experience severe allergic responses after getting a first shot shouldnt get covid-19 vaccines.

Efficacy is a consideration for patients whose underlying cancer or treatment suppresses their immune systems. Notably, patients with blood and lymph node cancers may experience a blunted response to vaccines, along with patients undergoing chemotherapy or radiation therapy.

Even in this case, we have every reason to believe that if their immune system is functioning at all, they will respond to the vaccine to some extent, and thats likely to be beneficial, said Dr. William Dale, chair of supportive care medicine and director of the Center for Cancer Aging Research at City of Hope, a comprehensive cancer center in Los Angeles County.

Balancing the timing of cancer treatment and immunization may be a consideration in some cases. For those with serious disease who need therapy as quickly as possible, we should not delay [cancer] treatment because we want to preserve immune function and vaccinate them against covid, said Hohl of Memorial Sloan Kettering.

One approach might be trying to time covid vaccination in between cycles of chemotherapy, if possible, said Dr. Catherine Liu, a professor in the vaccine and infectious disease division at Fred Hutchinson Cancer Research Center in Seattle.

In new guidelines published late last week, the National Comprehensive Cancer Network, an alliance of cancer centers, urged that patients undergoing active treatment be prioritized for vaccines as soon as possible. A notable exception: Patients whove received stem cell transplants or bone marrow transplants should wait at least three months before getting vaccines, the group recommended.

The American Cancer Societys chief medical and scientific officer, Dr. William Cance, said his organization is strongly in favor of cancer patients and cancer survivors getting vaccinated, particularly older adults. Given vaccine shortages, he also recommended that cancer patients who contract covid-19 get antibody therapies as soon as possible, if their oncologists believe theyre good candidates. These infusion therapies, from Eli Lilly and Co. and Regeneron Pharmaceuticals, rely on synthetic immune cells to help fight infections.

Q: Should my 97-year-old mom, in a nursing home with dementia, even get the covid vaccine?

The federal government and all 50 states recommend covid vaccines for long-term care residents, most of whom have Alzheimers disease or other types of cognitive impairment. This is an effort to stem the tide of covid-related illness and death that has swept through nursing homes and assisted living facilities 37% of all covid deaths as of mid-January.

The Alzheimers Association also strongly encourages immunization against covid-19, both for people [with dementia] living in long-term care and those living in the community, said Beth Kallmyer, vice president of care and support.

What I think this question is trying to ask is Will my loved one live long enough to see the benefit of being vaccinated? said Dr. Joshua Uy, medical director at a Philadelphia nursing home and geriatric fellowship director at the University of Pennsylvanias Perelman School of Medicine.

Potential benefits include not becoming ill or dying from covid-19, having visits from family or friends, engaging with other residents and taking part in activities, Uy suggested. (This is a partial list.) Since these benefits could start accruing a few weeks after residents in a facility are fully immunized, I would recommend the vaccine for a 97-year-old with significant dementia, Uy said.

Minimizing suffering is a key consideration, said Dr. Michael Rafii, associate professor of clinical neurology at the University of Southern Californias Keck School of Medicine. Even if a person has end-stage dementia, you want to do anything you can to reduce the risk of suffering. And this vaccine provides individuals with a good deal of protection from suffering severe covid, he said.

My advice is that everyone should get vaccinated, regardless of what stage of dementia theyre in, Rafii said. That includes dementia patients at the end of their lives in hospice care, he noted.

If possible, a loved one should be at hand for reassurance since being approached by someone wearing a mask and carrying a needle can evoke anxiety in dementia patients. Have the person administering the vaccine explain who they are, what theyre doing and why theyre wearing a mask in clear, simple language, Rafii suggested.

Q: Im 80 and I have Type 2 diabetes and an autoimmune disease. Should I get the vaccine?

There are two parts to this question. The first has to do with comorbidities having more than one medical condition. Should older adults with comorbidities get covid vaccines?

Absolutely, because theyre at higher risk of becoming seriously ill from covid, said Dr. Abinash Virk, an infectious diseases specialist and co-chair of the Mayo Clinics covid-19 vaccine rollout.

Pfizers and Modernas studies specifically looked at people who were older and had comorbidities, and they showed that vaccine response was similar to [that of] people who were younger, she noted.

The second part has to do with autoimmune illnesses such as lupus or rheumatoid arthritis, which also put people at higher risk. The concern here is that a vaccine might trigger inflammatory responses that could exacerbate these conditions.

Philippa Marrack, chair of the department of immunology and genomic medicine at National Jewish Health in Denver, said theres no scientifically rigorous data on how patients with autoimmune conditions respond to the Pfizer and Moderna vaccines.

So far, reasons for concern havent surfaced. More than 100,000 people have gotten these vaccines now, including some who probably had autoimmune disease, and theres been no systematic reporting of problems, Marrack said. If patients with autoimmune disorders are really worried, they should talk with their physicians about delaying immunization until other covid vaccines with different formulations become available, she suggested.

Last week, the National Multiple Sclerosis Society recommended that most patients with multiple sclerosis another serious autoimmune condition get the Pfizer or Moderna covid vaccines.

The vaccines are not likely to trigger an MS relapse or to worsen your chronic MS symptoms. The risk of getting COVID-19 far outweighs any risk of having an MS relapse from the vaccine, it said in a statement.

Were eager to hear from readers about questions youd like answered, problems youve been having with your care and advice you need in dealing with the health care system. Visitkhn.org/columniststo submit your requests or tips.

Judith Graham: khn.navigatingaging@gmail.com,@judith_graham

More here:
If I Have Cancer, Dementia or MS, Should I Get the Covid Vaccine? - Kaiser Health News

To Read More: If I Have Cancer, Dementia or MS, Should I Get the Covid Vaccine? – Kaiser Health News
categoriaBone Marrow Stem Cells commentoComments Off on If I Have Cancer, Dementia or MS, Should I Get the Covid Vaccine? – Kaiser Health News | dataJanuary 27th, 2021
Read All

[Full text] Post-Transplant Maintenance Therapy for Patients with Acute Myeloid Le | JBM – Dove Medical Press

By daniellenierenberg

Background

Acute myeloid leukemia (AML) remains the most common acute leukemia in adults with an incidence of 34 per 100,000 person per year. AML is a genetically and phenotypically heterogeneous and biologically dynamic spectrum of diseases.1 Indeed, the clinical outcomes are largely determined by the patients characteristics such as age, performance status and comoridities, as well as the leukemia features including the subtype (de novo versus secondary) and most importantly the genomic profile.2 The recent advances in defining the molecular landscape of AML and its role in leukemogenesis have paved the way for the development and adaptation of novel targeted agents.

Following induction chemotherapy, patients achieving a morphologic leukemia-free state (complete remission (CR)) are mandated to receive a form of consolidation therapy aimed at the residual leukemic stem cells (LSCs) to prevent relapse and improve overall survival (OS).3 A risk-adapted approach for relatively young or fit AML patients in first CR (CR1) involves the assessment of this risk of relapse, leading to either chemotherapy continuation or allogeneic stem cell transplantation (ASCT), taking into account the presence of comorbidities, the donor type as well as the genetic characteristics of the disease.4 In addition to pre-treatment risk stratification, the estimation of the leukemic burden while on therapy has recently emerged as a strong, independent and dynamic tool for individualizing post-induction treatment approaches. Either polymerase chain reaction (PCR), multiparameter flow cytometry (MFC) or the novel next-generation sequencing (NGS) can evaluate this measurable residual disease (MRD)57

Up to the current date, ASCT in first CR remains the most powerful antileukemic post-remission therapy. ASCT is generally recommended upfront for properly selected patients with high-risk cytogenetic features, those with intermediate and adverse-risk molecular findings, and patients with secondary AML. Patients with induction failure, post-induction residual disease and following salvage therapy are also referred for ASCT. In addition to potentially life-threatening complications of ASCT such as graft-versus-host disease (GVHD) and opportunistic infections, survival benefits recorded with ASCT are crippled by unacceptably high disease relapse rates,810 hence the need for strategies to maintain remission and prevent relapses post-ASCT. Such interventions aim at reinforcing the graft-versus-leukemia (GVL) effect and/or eradicating persistent MRD, especially with the increasing availability of more sensitive techniques to detect any residual disease. Nevertheless, these maintenance therapies may represent over-treatment for patients with intermediate-risk disease, further subjecting them to long-term toxicities and disturbed quality of life (QoL), thereby reinforcing the need for a better selection of patients as well as strict and continuous MRD monitoring.

The transplantation field has tremendously evolved over the last two decades with refinements of indications as well as improvement in the safety profile of conditioning regimens and supportive care strategies. Nonetheless, risk factors for increasing mortality after relapse in an allografted patient still include, among others, a shorter time to recurrence and occurrence of GVHD prior to relapse11 with significant improvement of overall survival (OS) for young patients relapsing in recent years (Bazarbachi et al, 2020).12 Furthermore, a deeper understanding of factors facilitating disease relapse, such as molecular profile and role of MRD, has enabled more high-risk patients to receive post-transplant therapies to treat and even prevent relapses. Indeed, pharmacological intervention and manipulation of the disease kinetics in the early post-transplant phase could potentially collaborate with other strategies to improve overall outcomes,13 possibly through up-regulation of tumor-associated antigens (TAA),14 expansion of regulatory T-cells,15 or acceleration of T-cell reconstitution.16 With the availability of a wide array of novel and less toxic agents such as epigenetic modifiers, tyrosine kinase inhibitors (TKIs), BCL2 inhibitors and immune checkpoint inhibitors (ICPIs) among others, an intriguing strategy would be to preemptively use such molecules in an attempt to prevent relapses post-ASCT in specific subsets of high-risk patients. Nevertheless, we currently only have few randomized trials that offered a survival advantage for maintenance therapy in AML.

Conducting either retrospective studies or prospective randomized trials to construct therapeutic strategies aiming at reducing post-ASCT relapse rates has been historically hampered by the depth of remission achieved as well as the intrinsic biologic apparatus of the disease. Cytogenetic abnormalities of AML knowingly dictate both the general outcomes of standard therapies and those following ASCT.17 In view of the granular advances in the field of myeloid malignancies, considering specific subsets of AML patients for post-ASCT maintenance should therefore depend on the molecular and genomic characteristics of the disease itself at diagnosis.18 Indeed, the presence of actionable or targetable mutations such as FLT3-ITD and IDH1/2 is a valuable opportunity to incorporate the approved corresponding inhibitors in the post-ASCT maintenance strategies. Novel molecular and MRD diagnostics are therefore of utmost importance to determine those who would benefit the most from personalized therapy options. As such, MRD status in the pre-transplant phase and more importantly detection of MRD early post-ASCT are crucial factors to implement therapy as they largely impact the likelihood and pace of disease relapse.19,20

In this setting, other variables including the donor source, intensity of conditioning regimen and GVHD prophylaxis protocols (T-cell depletion and post-ASCT cyclophosphamide) might influence the risk of disease relapse.21 While the implementation of reduced-intensity conditioning (RIC) has allowed more patients to receive ASCT,22 it could potentially increase the rate of post-transplant relapse, as demonstrated by the large prospective randomized Phase III trial conducted by the Bone Marrow Transplant Clinical Trials Network.23 Well-designed trials are eagerly needed to appropriately answer these challenging situations.

In the presence of few prospective randomized trials, the decision to initiate post-ASCT maintenance therapy remains ambivalent in many situations. Early-phase studies assessing novel agents in the relapsed setting often exclude patients with prior history of ASCT given the plethora of complications they might experience, therefore resorting to agents previously approved for different indications or settings. This dilemma largely provides a protective blanket to access these drugs on an off-label indication, which could impede recruitment for prospective studies. Additionally, most currently ongoing maintenance trials using hypomethylating agents (HMA), targeted therapies and other molecules still demand rigorous eligibility criteria, thereby interfering with enrollment rate.

Starting maintenance therapy in the early post-ASCT phase should take into account the concomitant use of immunosuppressive drugs and their potential heightened hematological and organ toxicities, the risk of opportunistic infections and GVHD, as well as the possible drugdrug interactions (such as with calcineurin inhibitors), even when the acute toxicities of ASCT have seemingly resolved. An optimal maintenance approach is therefore difficult to be intercalated within the conditioning regimen itself and is reserved for a post-ASCT phase, mostly started between days 30 and 100 following transplantation. In this setting, pre- and post-ASCT MRD status could be valuable in planning and timing maintenance therapy. For those patients with impending signs of relapse by MRD testing or falling donor chimerism, a preemptive maintenance therapy could be started early post-ASCT, before overt morphological relapse.

Finally, the optimal duration of maintenance therapy has not been established for most cases, thereby affecting the QoL of these patients.

The use of HMAs such as azacitidine and decitabine remains the most commonly adopted non-targeted strategy for the prevention of post-ASCT relapse owing in part to their acceptable safety profile.24 The mechanism of action of HMAs post-ASCT is unclear, but they appear to silence tumor suppressor genes through epigenetic modification. At the preclinical level, these agents could also induce a GVL effect through stimulation of CD8+ T-cell responses to overexpressed tumor-associated antigens (TAAs) such as MAGE antigens.25 This activity has led to the investigation of HMAs in a series of small trials, especially with the advancing field of MRD detection by sensitive techniques.

For example, AML patients with imminent relapse due to decreasing CD34 chimerism received pre-emptive azacitidine that delayed disease progression according to two studies.26,27 The concurrent administration of donor lymphocyte infusion (DLI) did not, however, improve response rates or OS27 and the majority of patients eventually experienced overt disease relapse.26 In another study, azacitidine was also given sequentially with DLI and showed a low relapse rate and encouraging OS despite the presence of acute and chronic GVHD.28

In a Phase I dose-finding trial, azacitidine as monotherapy was given between on day +42 post-ASCT to 45 patients with AML (82%) and MDS, for up to four cycles at different dose levels 8, 16, 24, 32, and 40 mg/m2.29 Interestingly, two-thirds of AML patients were not in CR at the time of transplant. The recommended dose of azacitidine was reported to be 32 mg/m2 for 5 days in 30-day cycles because of dose-limiting but reversible thrombocytopenia. At 1-year follow-up, the median disease-free survival (DFS) was 58% for all enrolled patients and the 1-year OS rate was 77%. In another phase I/II study of 27 AML patients who received a RIC regimen followed by ASCT later showed that the subcutaneous administration of up to 10 cycles of azacitidine at 36 mg/m2 for 5 days in 28-day cycles beginning at day 42 post-ASCT resulted in the expansion of circulating regulatory T-cells with subsequent GVL response and no significant GVHD.15 In a retrospective study of 18 allografted patients (13 AML and 5 MDS), including 50% of patients with a high or very high disease risk index, low-dose azacitidine started at a median of 60 days post-transplant was well tolerated and resulted in one-year disease-free survival (DFS) and OS of 63% and 70%, respectively.30 A subsequent randomized phase III trial comparing azacitidine at 32 mg/m2 subcutaneously for 5 days in up to 12, 28-day cycles to no intervention in 87 patients with AML, myelodysplastic syndromes (MDS) or chronic myelomonocytic leukemia in remission was terminated early because of slow accrual.31 At a median follow-up of 4.6 years in the azacitidine arm, available data suggest no significant effect of the HMA on relapse-free survival (RFS), except for a non-statistically significant trend for improvement in those who received at least 9 cycles of therapy.

The importance of MRD-adapted therapy is highlighted in the ongoing Phase II study (RELAZA2) whereby preemptive treatment with at least 6 cycles of azacitidine (75 mg/m2 7 days) and for up to 18 additional months was evaluated.32 The study enrolled patients in CR but with detectable MRD either after conventional chemotherapy or following ASCT. This preemptive MRD risk-adapted strategy was found to prevent or significantly delay disease relapse in 58% of patients who remained in CR after 6 months (95% CI: 4472; p < 0.001). These results are encouraging and warrant further follow-up.

More recently, an oral azacitidine formulation CC-486 with extended dosing to prolong activity of azacitidine with sustained DNA hypomethylation showed promising results as maintenance therapy in a randomized trial following induction chemotherapy for AML.33 CC-486 was then evaluated in a phase I/II trial of 30 patients (26 with AML and 4 MDS) who had undergone ASCT, given at 200300 mg orally for 7 days or 150200 mg orally for 14 days in up to 12, 28-day cycles.34 The study resulted in 1-year RFS rates of 54% with the 7-day protocol and 72% with the 14-day regimen in the 28 evaluable patients, leading to estimated 1-year survival rates of 86% and 81%, respectively. The most common grade 34 treatment-related toxicities were gastrointestinal and hematologic toxicities, and two patients experienced severe chronic GVHD. A randomized, phase III trial evaluating CC-486 at the 200 mg 14-day dosing regimen as maintenance therapy post-ASCT for high-risk MDS and intermediate- or high-risk AML is currently enrolling.

On the other hand, a small study of decitabine administered at 515 mg/m2 intravenously for 5 days starting 50100 days post ASCT for up to 8, 6-week cycles also exhibited favorable results with 2-year OS of 56% and cumulative incidence of relapse reaching 28%.35 However, the majority (75%) of patients experienced grade 34 hematologic toxicities during therapy. While decitabine did not increase the rate of chronic GVHD, there was a trend for increased FOXP3 expression and T-reg cells in the lymphocyte environment in a correlative study that was not statistically meaningful.

Interpreting the results of these studies remains challenging and controversial, as they are small and mostly uncontrolled. As such, the optimal timing of HMA initiation post-ASCT and dosing need to be explored further to establish efficacy at preventing relapses and avoid unnecessary toxicities, especially in patients who can be cured with ASCT alone. In patients with detectable MRD or mixed chimerism, pre-emptive treatment with HMA could potentially delay or even prevent relapses in AML and MDS patients.36

More recently, there has been a growing interest in evaluating HMA as partners to novel promising agents such as the BCL2 inhibitor venetoclax, ICPs, FLT3 inhibitors, as well as isocitrate dehydrogenase (IDH) inhibitors and studies are ongoing (Table 1).

Table 1 Some of the Ongoing Trials Evaluating Various Targets for Post-Allogeneic Stem Cell Transplantation Strategies

The class I/II HDACi have presented as potential promising agents in AML/MDS owing to large induction effects on cell-cycle arrest and differentiation, as well as pro-apoptotic effects on myeloid cells through epigenetic modifications of histones.37 HDACi have also exhibited some antileukemic and immunomodulatory roles through the control of cytokine secretion. This is further evidenced by the panobinostat activity, a potent oral inhibitor of class 1, 2, and 4 deacetylases, in the PANOBEST trial.38 This study enrolled 42 patients with high-risk AML or MDS who had received ASCT and panobinostat was started at a median of 98 days (60150) post-ASCT. Two-thirds of these patients were transplanted in active disease. While only 22 (54%) of the 42 patients completed 1 year of therapy because of adverse events, the cumulative incidence at relapse remained 21% at 2 years, resulting in 2-year OS and DFS rates of 88% and 74%. More importantly, panobinostat was found to inhibit the suppressive function of T-regs when used at low doses and enhance their function at higher doses,39 thereby playing a possible role in reducing GVHD. As these results are intriguing, a randomized multicenter phase III trial is currently comparing panobinostat 20 mg orally three times weekly every second week to the standard of care as maintenance post-ASCT. Vorinostat, another HDACi, is also being combined with low-dose azacytidine for post-ASCT in a currently ongoing phase I dose-escalation clinical trial.

Treatment of FLT3-ITD mutated AML remains challenging due to significant relapse rates and short remissions with available therapies despite the common historical use of ASCT in first CR.40 Nevertheless, FLT3-mutated AML is a heterogeneous disease that entails diversity in the type of FLT3 mutations and their insertion site, the FLT3-ITD allelic burden, and the presence of concurrent mutations; observations that further complicated the decision to proceed to ASCT in the first CR when feasible.4143 This controversy is evidenced by the European LeukemiaNet guidelines suggesting, with some controversy, that ASCT should not be offered to patients with low-mutant allelic ratio.4446 EBMT guidelines allowed ASCT in this setting and recommended it for all patients with FLT3-mutated AML (Bazarbachi et al, 2020).47

As such, the use of multi-kinase inhibitors of various generations has led to improved outcomes and achievement of deeper responses in FLT3-mutated AML. These TKIs, together with the incorporation of MRD assessment, have enabled the installation of post-transplant therapeutic strategies,48 as the 1-year OS of patients who relapse post-ASCT drops to less than 20%.11 (Bazarbachi et al, 2020).12

The enthusiasm of using FLT3 TKIs stems not only from their direct cytotoxic properties but also involve an immunomodulatory effect synergizing with allografted T-cells. Several murine models have shown that sorafenib enhances the production of interleukin-15 (IL-15) production by leukemic cells, thereby promoting GVL effect.16 The same experiment showed that sorafenib reduced the activating transcription factor (ATF4) expression in leukemic cells, a negative regulator of IRF-7 interferon regulatory factor-7 (IRF-7) activation, which further enhances IL-15 transcription when activated. The exact mechanisms of FLT3 TKIs immunogenicity remain to be elucidated.

One of the earliest and most promising post-transplant maintenance approaches has been the administration of FLT3 inhibitors, limited to date to FLT3-ITD mutated AML patients. Despite multiple retrospective and prospective randomized trials evaluating the efficacy and safety of the use of FLT3 inhibitors as post-transplant maintenance, there is still a debate on the best agent to be used (off-label use of sorafenib versus potent second-generation FLT3 inhibitors), dosing and time of initiation. A consensus by the EBMT Acute Leukemia Working Party recommended the use of sorafenib 400 mg twice daily in the post-transplant setting in the absence of active GVHD based on available data (Bazarbachi et al, 2020).47 Previous retrospective studies have demonstrated a lower risk of disease relapse following ASCT in patients with FLT3 ITD mutated AML who received post-transplant sorafenib maintenance (Antar, et al, 2014).4953

In a phase I study involving 22 patients with FLT3-ITD AML receiving sorafenib maintenance post-ASCT, PFS at 1 year was 85% and OS was 95%.54 Encouraging results were subsequently reported in other small trials of sorafenib maintenance compared to historical controls, showing markedly lower relapse rates, improved RFS and relatively tolerable toxicities, while not significantly affecting the rates of GVHD.5153,5557 This is further supported by two registry studies from the European Society for Blood and Marrow Transplantation (EBMT) showing that post-transplant maintenance with sorafenib improved OS and leukemia-free survival (LFS) of allografted patients with FLT3-ITD positive AML (Bazarbachi et al, 2019)58 and that sorafenib combined with DLI clearly improved OS and LFS of relapsed FLT3-ITD positive AML patients following ASCT. (Bazarbachi et al, 2019)59

In a prospective phase II controlled randomized trial (SORMAIN) of 83 patients with FLT3-ITD mutated AML, the administration of sorafenib for up to 24 months resulted in superior outcomes for patients in CR and no grade 2 GVHD compared to placebo. After a long median follow-up of 42 months, the 2-year RFS was 85% in the sorafenib group compared with 53% in the placebo group (HR=0.39, p=0.01), in addition to an OS benefit for the sorafenib group (HR=0.447; p=0.03).60 Further follow-up showed that many patients will experience disease relapse when sorafenib is stopped at 24 months, suggesting a longer exposure to sorafenib might be needed to prevent late relapses. While SORMAIN trial constitutes the first placebo-controlled evidence that post-HSCT maintenance therapy could reduce the risk of relapse and death, this study enrolled patients who underwent transplantation in the first hematological CR, as well as those in the second or subsequent CR. Finally, the Chinese open-label, large randomized phase III trial assigned patients to receive sorafenib maintenance (n=100) or control (n=102) post-ASCT (Xuan et al 2020).61 At a median follow-up of 21.3 months, the 1-year cumulative incidence of relapse was 7.0% (95% CI 3.113.1) in the sorafenib group and 24.5% (16.633.2) in the control group (hazard ratio 0.25, 95% CI 0.110.57; p=0.0010), with no treatment-related deaths and acceptable GVHD rates. Based on these available data, sorafenib is recommended by many authorities as a maintenance strategy to reduce post-ASCT relapses for FLT3-ITD-mutated AML (Bazarbachi et al, 2020).47

More recent data from the RATIFY trial that led to the US Food and Drug Administration (FDA) approval of midostaurin in 2017, proposed that the outcomes of patients who received this agent prior to ASCT were particularly encouraging.62 In a phase II trial of midostaurin received as post-consolidation or post-ASCT maintenance, the 1-year relapse rate was encouragingly low at 9.2%.63 In this German-Austrian AML Study Group 1610, most patients discontinued midostaurin earlier than planned because of toxicities. This remains in line with prior reports on the drugs complex pharmacokinetic profile and drugdrug interactions that warrant close observation and dose adjustments to reduce toxicity.64,65

RADIUS is another phase II randomized study that accrued 60 patients with FLT3-ITD AML with stable engraftment post-ASCT to receive or not midostaurin for twelve 4-week cycles.66 Unsurprisingly, the median RFS was not reached for either arm as the trial was not powered to detect any statistical difference (p=0.34) between subgroups.

The prospective cooperative group international phase III randomized trial (BMT-CTN 1506; NCT02997202) is seeking to confirm the impact of post-transplant gilteritinib maintenance therapy versus placebo in patients with FLT3-mutated AML and has completed accrual at 346 patients. Gilteritinib is an effective and tolerable FLT3 inhibitor, with potent activity against both FLT3-ITD and FLT3-TKD mutations, particularly the kinase domain mutations at residue D835 and the gatekeeper mutation at residue F691.67 Gilteritinib was recently approved for use in the relapsed/refractory setting68 and was chosen for evaluation as post-ASCT maintenance owing to its safety profile and potent inhibition of FLT3 in vivo. Unfortunately, the use of placebo as control arm in this trial will not allow to answer the important question of whether Gilteritinib offers an additional benefit over sorafenib in that setting.

Quizartinib (AC220), a highly potent selective FLT3-ITD inhibitor was also studied in one small phase I trial where only 1 of 13 patients relapsed under therapy at the last follow-up.69 Furthermore, toxicities were manageable and GVHD rate was not increased. However, increasing reports about resistance through point-mutant forms have been emerging, hence limiting single-agent use.70

Crenolanib, like gilteritinib, is another potent oral type 1 FLT3 TKI with extended activity against FLT3-ITD and resistance-conferring FLT3-D835 TKD mutants.71 It is also under evaluation as a post-ASCT maintenance in a phase II trial (NCT02400255), in a cohort of patients transplanted in CR and in another group allografted with the residual disease with 10% bone marrow blasts. Crenolanib is started between days 45 to 90 after ASCT and for up to 2 years. It is important to note that phase II/III trials of post-ASCT maintenance involving the novel FLT3 TKIs do not use a first-generation inhibitor control, making it difficult to establish their superior efficacy in this setting.

Some unanswered questions remain regarding the use of FLT3 TKIs as maintenance post-ASCT. FLT3-ITD mutations, unlike BCR-ABL1 fusions,72 are not founding mutations but rather an important final step and one of many mutations found in leukemogenesis.73,74 These include WT1, IDH1, DNMT3A, as well as NUP98/NSD1 fusions, which are currently known to affect outcomes and response to therapy. Furthermore, FLT3 measuring assays are not cross-validated within trials along with considerable variability in the FLT3-ITD cut-off used (0.5 in the ELN recommendations, 0.7 in the RATIFY study) for treatment, as well as the dynamic changes that happen to this ratio over time. Until standardization of definitions, the indication of ASCT remains itself controversial in patients with low (<0.5) allelic ratio FLT3-ITD who have a concomitant NPM1 mutation and achieve MRD negative status on therapy (Bazarbachi et al, 2020).47

Ivosidenib and enasidenib have been recently approved for the treatment of IDH1 and IDH2-mutated AML, respectively.75,76 Owing to the natural history of this subtype of AML and the relative safety of these agents, they could present as a promising option for maintenance therapy post-ASCT. Some trials (NCT03515512, NCT03564821) are currently evaluating the significance of these mutations and their role in post-ASCT relapses, as well as the safety of the corresponding targeted agents in this setting.

Venetoclax is a BCL2 inhibitor that competitively binds to the BH3 domain of BCL2, an anti-apoptotic protein, releases BH3-only proteins and induces apoptosis of hematologic malignant cells.77 Venetoclax has been evaluated and is currently approved in combination with low-dose cytarabine and azacitidine or decitabine.78,79 These studies have included only a few patients who relapsed after ASCT and still achieved CR with the combination. Two prospective trials investigating the efficacy of venetoclax in combination with azacitidine at improving RFS are currently enrolling AML patients for maintenance or preemptive therapy post-ASCT.

Anomalous hedgehog (Hh) pathway signaling is involved in the survival and proliferation of leukemia stem cells,80 especially those resistant to chemotherapy.81 Glasdegib, an oral small Hh inhibitor, has been recently FDA approved in combination with low-dose cytarabine for the treatment of AML patients not eligible for intensive therapy, after showing OS benefit.82 Based on these findings, glasdegib is currently being evaluated in a phase II study for post-ASCT maintenance for AML patients at high-risk of relapse (NCT01841333).

AML and MDS with abnormal 17p or mutated p53 are known to portend dismal outcomes with the highest risk of relapse even in the post-ASCT phase.83 APR-246 is an agent that targets p53 mutation in an attempt to restore its function and showed up to 80% CR rate in an early trial of patients with myeloid malignancies.84 Based on this concept, a phase II trial studying the combination of azacytidine and APR-246 is currently enrolling allografted patients with MDS and AML and mutated p53 (NCT03931291) with a primary endpoint being 1-year RFS.

The use of antibody-drug conjugates (ADC) could achieve target specificity through inhibition of certain surface markers, such as CD33, expressed on the majority of myeloblasts. Gemtuzumab ozogamicin (GO) is a MoAb against CD33 conjugated to the toxin calicheamicin. In a small study of 10 relatively young patients allografted for high-risk AML, GO was administered with azacitidine as maintenance post-ASCT.85 After a median number of 1.5 cycles only complicated by reversible hematological toxicities, 40% of patients relapsed.

Another newer generation anti-CD33 ADC Vadastuximab talirine (SGN33a) conjugated to a pyrrolobenzodiazepine dimer was studied as maintenance in the post-ASCT setting (NCT02326584), but the phase I/II trial was terminated early because of neutropenia and thrombocytopenia.

Maintenance therapy with immune checkpoint inhibitors, such as nivolumab, is being investigated in clinical trials for patients with high-risk AML in remission post-consolidation, who are not candidates for ASCT.86 For instance, using this selective immune modulation for post-ASCT maintenance may provide similar benefits and merits investigation owing to their inherent activity in AML. Nonetheless, issues related to acute GVHD are likely to emerge, as seen with previous studies of lenalidomide in this setting,87 thereby limiting the wide adoption of these agents.8890

Other agents on the outlook in this setting include anti-chemokine (C-X-C motif) receptor 4 (CXCR4) as well as CAR T-cell therapy.

AML has increasingly presented itself as a poster child for personalized treatment approaches. ASCT by itself should not be regarded as an ultimate definitive therapy for all patients and with established poor outcomes for post-ASCT relapses, preventing one remains more beneficial than treating it. Nonetheless, we still have no simple algorithm or strategy to address post-ASCT relapses or maintenance approaches. As delineated above, most available information is derived from phase II trials of HMAs and FTL3-ITD TKIs and few randomized data. Recent development of targeted agents made their use in the post-transplant setting more exciting taking into consideration the potential risks on GVHD and immune reconstitution post-ASCT. Furthermore, better MRD assessments facilitated the optimal selection of high-risk candidates who would benefit from such strategies.

Any treatment decision should therefore involve the patients performance status, the pre-transplant disease course, the presence of actionable mutations, and the use of concurrent immunosuppressive medications as well as GVHD. Prognostication of high-risk AML patients has been recently refined, especially with the introduction of various MRD assays. These include MFC5,91 and NGS-MRD monitoring, both shown to be predictive for post-transplant relapse and survival.92,93

In our clinical practice, we utilize patient and disease characteristics coupled with pre- and post-transplant MRD assays as metrics to counsel patients about their risk of relapse. Awaiting further validation, we believe these are useful parameters, especially when conjugated to risk-stratified maintenance approaches. Nonetheless, we recommend the use of off-label FLT3-TKIs such as sorafenib because of our favorable experience and the accumulating data with this regard, which led to the EBMT recommendations (Bazarbachi et al, 2020).47 HMAs still represent a cornerstone maneuver to upregulate neoantigens and modulate immune responses post-ASCT when used alone or in various upcoming combinations (HMA+ DLI or venetoclax, etc.). One would, however, ask if pre-transplant therapy matters in this setting and whether responding favorably or not to azacitidine as initial therapy could affect the outcomes of post-ASCT maintenance. Novel agents such as ADCs and BCL2-inhibitors may provide a favorable approach despite little knowledge about the effect of these molecules on the graft and their potential toxicities. Immune stimulation with agents such as ICPs currently remains investigational awaiting well-designed clinical trials. Additionally, we must continue to explore the genetic profiling of AML and its ramifications.

Disease relapse remains a paramount endpoint to treating physicians and patients, far beyond the use of survival endpoints alone based on small single-center trials. With the recent surge of therapeutic opportunities, the priority should be to tailor randomized trials with refined conditioning regimens to post-transplant strategies while routinely incorporating MRD and genomic assays. This will require a solid partnership between the transplant community, academia and the pharmaceutical institutions for innovative and well-integrated approaches. A model trial in this setting also needs to assess the activity of a certain approach and its effect on GVHD. There is a steadily increasing number of novel agents, mostly of oral bioavailability, which could be preferred for maintenance therapy owing to their activity, dosing schedules, as well as minimal hematological toxicities. Other areas of interest include the use of MoAbs, ICP inhibitors and possibly products of cellular engineering (vaccines, modified chimeric antigen receptor T-cells, etc.). As a reflection of toxicities, we strongly support the integration of quality-of-life (QoL) metrics and patient-reported outcomes as informative endpoints in the design of these prospective randomized trials.

The authors report no conflicts of interest in this work.

1. The Cancer Genome Atlas Research Network. Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. N Engl J Med. 2013;368:20592207. doi:10.1056/NEJMoa1301689

2. Dhner H, Estey E, Amadori S, et al. Diagnosis and management of acute myeloid leukemia in adults: recommendations from an international expert panel, on behalf of the European LeukemiaNet. Blood. 2010;115(3):453474.

3. Burnett A, Russell N, Hills R, et al. A randomized comparison of daunorubicin 90 mg/m2 vs 60 mg/m2 in AML induction: results from the UK NCRI AML17 trial in 1206 patients. Blood. 2015;125(25):38783885. doi:10.1182/blood-2015-01-623447

4. Marcucci G, Haferlach T, Dhner H. Molecular genetics of adult acute myeloid leukemia: prognostic and therapeutic implications. J Clin Oncol. 2011;29(5):475486. doi:10.1200/JCO.2010.30.2554

5. Terwijn M, van Putten W, Kelder A, van der Velden V, Brooimans R, Pabst T. High prognostic impact of flow cytometric minimal residual disease detection in acute myeloid leukemia: data from the HOVON/SAKK AML 42A study. J Clin Oncol. 2013;31(31):38893897. doi:10.1200/JCO.2012.45.9628

6. Ivey A, Hills R, Simpson MA, et al. Assessment of minimal residual disease in standard- risk AML. N Engl J Med. 2016;374:422433. doi:10.1056/NEJMoa1507471

7. Freeman S, Hills R, Virgo P, et al. Measurable residual disease at induction redefines partial response in acute myeloid leukemia and stratifies outcomes in patients at standard risk without NPM1 mutations. J Clin Oncol. 2018;36(15):14861497. doi:10.1200/JCO.2017.76.3425

8. Wingard J, Majhail N, Brazauskas R, et al. Long-term survival and late deaths after allogeneic hematopoietic cell transplantation. J Clin Oncol. 2011;29(16):22302239. doi:10.1200/JCO.2010.33.7212

9. Bejanyan N, Weisdorf D, Logan B, et al. Survival of patients with acute myeloid leukemia relapsing after allogeneic hematopoietic cell transplantation: a center for International Blood and Marrow Transplant Research Study. Biol Blood Marrow Transplant. 2015;21(3):454459. doi:10.1016/j.bbmt.2014.11.007

10. Ganzel C, Sun Z, Cripe L, et al. Very poor long-term survival in past and more recent studies for relapsed AML patients: the ECOG-ACRIN experience. Am J Hematol. 2018;93:10741081. doi:10.1002/ajh.25162

11. Thanarajasingam G, Kim H, Cutler C, et al. Outcome and prognostic factors for patients who relapse after allogeneic hematopoietic stem cell transplantation. Biol Blood Marrow Transplant. 2013;19(12):17131718. doi:10.1016/j.bbmt.2013.09.011

12. Bazarbachi A, Schmid C, Labopin M, et al. Evaluation of trends and prognosis over time in patients with AML relapsing after allogeneic hematopoeitic cell transplant reveals improved survival for young patients in recent years. Clin Cancer Res. 2020b;3134.

13. Craddock C. Pharmacological methods to reduce disease recurrence. Hematology Am Soc Hematol Educ Program. 2013;2013:6369. doi:10.1182/asheducation-2013.1.63

14. Choi J, Ritchey J, Prior J, et al. In vivo administration of hypomethylating agents mitigate graft-versus host disease without sacrificing graft-versus-leukemia. Blood. 2010;116(1):129139. doi:10.1182/blood-2009-12-257253

15. Goodyear O, Dennis M, Jilani N, et al. Azacitidine augments expansion of regulatory T cells after allogeneic stem cell transplantation in patients with acute myeloid leukemia (AML). Blood. 2012;119(14):33613369. doi:10.1182/blood-2011-09-377044

16. Mathew N, Baumgartner F, Braun L, et al. Sorafenib promotes graft-versus-leukemia activity in mice and humans through IL-15 production in FLT3-ITD-mutant leukemia cells. Nat Med. 2018;24(3):282291. doi:10.1038/nm.4484

17. Armand P, Kim H, Zhang M, et al. Classifying cytogenetics in patients with acute myelogenous leukemia in complete remission undergoing allogeneic transplantation: a Center for International Blood and Marrow Transplant Research study. Biol Blood Marrow Transplant. 2012;18(2):280288. doi:10.1016/j.bbmt.2011.07.024

18. Schlenk R, Dhner K, Krauter J, et al. Mutations and treatment outcome in cytogenetically normal acute myeloid leukemia. N Engl J Med. 2008;358:19091918. doi:10.1056/NEJMoa074306

19. Walter R, Buckley S, Pagel J, et al. Significance of minimal residual disease before myeloablative allogeneic hematopoietic cell transplantation for AML in first and second complete remission. Blood. 2013;122(10):18131821. doi:10.1182/blood-2013-06-506725

20. Festuccia M, Deeg H, Gooley T, et al. Minimal identifiable disease and the role of conditioning intensity in hematopoietic cell transplantation for myelodysplastic syndrome and acute myelogenous leukemia evolving from myelodysplastic syndrome. Biol Blood Marrow Transplant. 2016;22(7):12271233. doi:10.1016/j.bbmt.2016.03.029

21. Milano F, Gooley T, Wood B, et al. Cord blood transplant in patients with minimal residual disease. N Engl J Med. 2016;375:944953. doi:10.1056/NEJMoa1602074

22. DSouza A, Lee S, Zhu X, Pasquini M. Current use and trends in hematopoietic cell transplantation in the United States. Biol Blood Marrow Transplant. 2017;23(9):14171421. doi:10.1016/j.bbmt.2017.05.035

23. Scott B, Pasquini M, Logan B, et al. Myeloablative versus reduced-intensity hematopoietic cell transplantation for acute myeloid leukemia and myelodysplastic syndromes. J Clin Oncol. 2017;35(11):11541161. doi:10.1200/JCO.2016.70.7091

24. Cruijsen M, Hobo W, van der Velden W, et al. Addition of 10-day decitabine to fludarabine/total body irradiation conditioning is feasible and induces tumor-associated antigen specific T cell responses. Biol Blood Marrow Transplant. 2016;22(6):10001008. doi:10.1016/j.bbmt.2016.02.003

25. Snchez-Abarca L, Gutierrez-Cosio S, Santamara C, et al. Immunomodulatory effect of 5-azacytidine (5-azaC): potential role in the transplantation setting. Blood. 2010;115(1):107121. doi:10.1182/blood-2009-03-210393

26. Platzbecker U, Wermke M, Radke J, et al. Azacitidine for treatment of imminent relapse in MDS or AML patients after allogeneic HSCT: results of the RELAZA trial. Leukemia. 2012;26(3):381389. doi:10.1038/leu.2011.234

27. Craddock C, Jilani N, Siddique S, et al. Tolerability and clinical activity of posttransplantation Azacitidine in patients allografted for acute myeloid leukemia treated on the RICAZA trial. Biol Blood Marrow Transplant. 2016;22(2):385390. doi:10.1016/j.bbmt.2015.09.004

28. Guillaume T, Florent Malard F, Leonardo Magro L, et al. Prospective phase II study of prophylactic low-dose azacitidine and donor lymphocyte infusions following allogeneic hematopoietic stem cell transplantation for high-risk acute myeloid leukemia and myelodysplastic syndrome. Bone Marrow Transplant. 2019;54(11):18151826. doi:10.1038/s41409-019-0536-y

29. de Lima M, Giralt S, Thall P, et al. Maintenance therapy with low-dose azacitidine after allogeneic hematopoietic stem cell transplantation for recurrent acute myelogenous leukemia or myelodysplastic syndrome. Cancer. 2010;116(23):54205431. doi:10.1002/cncr.25500

30. El-Cheikh J, Massoud R, Fares E, et al. Low-dose 5-azacytidine as preventive therapy for relapse of AML and MDS following allogeneic HCT. Bone Marrow Transplant. 2017;52(6):918921. doi:10.1038/bmt.2017.31

31. Oran B, de Lima M, Garcia-Manero G, et al. Maintenance with 5-azacytidine for acute myeloid leukemia and myelodysplastic syndrome patients. Blood. 2018;132(Supplement 1):971. doi:10.1182/blood-2018-99-111582

32. Platzbecker U, Middeke J, Sockel K, et al. Minimal-residual disease guided treatment with azacitidine in MDS/AML patients at imminent risk of relapse: results of the prospective RELAZA2 trial. Blood. 2017;130(Supplement 1):565.

33. Wei AH, Dhner H, Pocock C, et al. The QUAZAR AML-001 maintenance trial: results of a phase III international, randomized, double-blind, placebo-controlled study of CC-486 (oral formulation of azacitidine) in patients with acute myeloid leukemia (AML) in first remission. Blood. 2019;134(suppl2):LBA3. doi:10.1182/blood-2019-132405

34. de Lima M, Oran B, Champlin R, et al. CC-486 maintenance after stem cell transplantation in patients with acute myeloid leukemia or myelodysplastic syndromes. Biol Blood Marrow Transplant. 2018;24(10):20172024. doi:10.1016/j.bbmt.2018.06.016

35. Pusic I, Choi J, Fiala M, et al. Maintenance therapy with decitabine after allogeneic stem cell transplantation for acute myelogenous leukemia and myelodysplastic syndrome. Bone Marrow Transplant. 2015;21(10):17611769. doi:10.1016/j.bbmt.2015.05.026

36. Platzbecker U, Middeke J, Sockel K, et al. Measurable residual disease-guided treatment with azacitidine to prevent haematological relapse in patients with myelodysplastic syndrome and acute myeloid leukaemia (RELAZA2): an open-label, multicentre, Phase 2 trial. Lancet Oncol. 2018;19(12):16681679. doi:10.1016/S1470-2045(18)30580-1

37. Stahl M, Gore S, Vey N, Prebet T. Lost in translation? Ten years of development of histone deacetylase inhibitors in acute myeloid leukemia and myelodysplastic syndromes. Expert Opin Investig Drugs. 2016;25(3):307317. doi:10.1517/13543784.2016.1146251

38. Bug G, Burchert A, Wagner E-M, et al. Phase I/II study of the deacetylase inhibitor panobinostat after allogeneic stem cell transplantation in patients with high-risk MDS or AML (PANOBEST trial). Leukemia. 2017;31(11):25232525. doi:10.1038/leu.2017.242

39. Shen L, Pili R. Class I histone deacetylase inhibition is a novel mechanism to target regulatory T cells in immunotherapy. Oncoimmunology. 2012;1(6):948950. doi:10.4161/onci.20306

40. Brunet S, Labopin M, Esteve J, et al. Impact of FLT3 internal tandem duplication on the outcome of related and unrelated hematopoietic transplantation for adult acute myeloid leukemia in first remission: a retrospective analysis. J Clin Oncol. 2012;30(7):735741. doi:10.1200/JCO.2011.36.9868

41. Kayser S, Dohner K, Krauter J, et al. Impact of allogeneic transplantation from matched related and unrelated donors on clinical outcome in younger adult AML patients with FLT3 internal tandem duplications. Blood. 2010;116(21):909. doi:10.1182/blood.V116.21.909.909

42. Sengsayadeth S, Jagasia M, Engelhardt B, et al. Allo-SCT for high-risk AML-CR1 in the molecular era: impact of FLT3/ITD outweighs the conventional markers. Bone Marrow Transplant. 2012;47(12):15351537. doi:10.1038/bmt.2012.88

43. Deol A, Sengsayadeth S, Ahn K, et al. Does FLT3 mutation impact survival after hematopoietic stem cell transplantation for acute myeloid leukemia? A Center for International Blood and Marrow Transplant Research (CIBMTR) analysis. Cancer. 2016;122(19):30053014. doi:10.1002/cncr.30140

44. Dhner H, Estey E, Grimwade D, et al. Diagnosis and management of AML in adults: 2017 ELN recommendations from an international expert panel. Blood. 2017;129(4):424447.

45. Sakaguchi M, Yamaguchi H, Najima Y, et al. Prognostic impact of low allelic ratio FLT3-ITD and NPM1 mutation in acute myeloid leukemia. Blood Adv. 2018;2(20):27442754. doi:10.1182/bloodadvances.2018020305

46. Straube J, Ling V, Hill G, Lane S. The impact of age, NPM1mut, and FLT3ITD allelic ratio in patients with acute myeloid leukemia. Blood. 2018;131(10):11481153. doi:10.1182/blood-2017-09-807438

47. Bazarbachi A, Bug G, Baron F, et al. Clinical practice recommendation on hematopoietic stem cell transplantation for acute myeloid leukemia patients with FLT3-internal tandem duplication: a position statement from the Acute Leukemia Working Party of the European Society for Blood and Marrow. Haematologica. 2020a;105(6):15071516. doi:10.3324/haematol.2019.243410

48. Schuurhuis G, Heuser M, Freeman S, et al. Minimal/measurable residual disease in AML: a consensus document from the European LeukemiaNet MRD Working Party. Blood. 2018;131(12):12751291. doi:10.1182/blood-2017-09-801498

49. Antar, A., Kharfan-Dabaja, M, Mahfouz, R, & Bazarbachi, A. Sorafenib maintenance appears safe and improves clinical outcomes in FLT3-ITD acute myeloid leukemia after allogeneic hematopoietic cell transplantation. Clin Lymphoma Myeloma Leuk. 2015;15(5):298302.

50. Borthakur G, Kantarjian H, Farhad Ravandi F, et al. Phase I study of sorafenib in patients with refractory or relapsed acute leukemias. Haematologica. 2011;96(1):6268. doi:10.3324/haematol.2010.030452

51. Brunner A, Li S, Fathi A, et al. Haematopoietic cell transplantation with and without sorafenib maintenance for patients with FLT3-ITD acute myeloid leukaemia in first complete remission. Br J Haematol. 2016;175(3):496504. doi:10.1111/bjh.14260

52. Battipaglia G, Ruggeri A, Massoud R, et al. Efficacy and feasibility of sorafenib as a maintenance agent after allogeneic hematopoietic stem cell transplantation for Fms-like tyrosine kinase 3-mutated acute myeloid leukemia. Cancer. 2017;123(15):28672874. doi:10.1002/cncr.30680

53. Battipaglia G, Massoud R, Ahmed S, et al. Efficacy and feasibility of sorafenib as a maintenance agent after allogeneic hematopoietic stem cell transplantation for Fms-like tyrosine kinase 3 mutated acute myeloid leukemia: an update. Clin Lymphoma Myeloma Leuk. 2019;19(8):506508. doi:10.1016/j.clml.2019.04.004

54. Chen Y, Li S, Lane A, et al. Phase I trial of maintenance sorafenib after allogeneic hematopoietic stem cell transplantation for fms like tyrosine kinase 3 internal tandem duplication acute myeloid leukemia. Biol Blood Marrow Transplant. 2014;20(12):20422048. doi:10.1016/j.bbmt.2014.09.007

55. Sammons S, Pratz K, Smith B, Karp J, Emadi A. Sorafenib is tolerable and improves clinical outcomes in patients with FLT3-ITD acute myeloid leukemia prior to stem cell transplant and after relapse post-transplant. Am J Hematol. 2014;89(9):936938. doi:10.1002/ajh.23782

Read the original here:
[Full text] Post-Transplant Maintenance Therapy for Patients with Acute Myeloid Le | JBM - Dove Medical Press

To Read More: [Full text] Post-Transplant Maintenance Therapy for Patients with Acute Myeloid Le | JBM – Dove Medical Press
categoriaBone Marrow Stem Cells commentoComments Off on [Full text] Post-Transplant Maintenance Therapy for Patients with Acute Myeloid Le | JBM – Dove Medical Press | dataJanuary 27th, 2021
Read All

Onward and Upward for Single-Use Systems in Bioprocessing – Medical Device and Diagnostics Industry

By daniellenierenberg

The single-use device market is primed for growth. Single-use systems (SUS) are now used for about 85 percent of precommercial scale (preclinical and clinical) biopharmaceutical manufacturing and increasingly for commercial products manufacturing. This shift from fixed stainless steel appears to be revolutionizing the therapeutics market.

While large-scale, fixed stainless-steel equipment-based bioprocessing facilities continue producing biopharmaceuticals, the market for SUS, composed primarily of plastic components that are sealed and sterilized using gamma irradiation, continues its rapid ascent. Medical device makers are seeing growth in single-use instruments and disposable medical devices, including process containers, tubing, connectors, baskets, and valves. According to Grand View Research, in 2019, the global SUS market was valued at $12.6 billion, with a 12.8 percent compound annual growth rate forecast through 2027, when it will top $33 billion.

Lower energy and direct-labor costs plus faster changeover times are important reasons why. Like any major change, the SUS shift brings with it challenges as pharmaceutical manufacturers and medical device makers turn to their suppliers to provide assurance that their products deploy operational best practices and are certifiably safe.

To address key challenges in the SUS market and meet the product development needs of Tier 1 pharmaceutical and medical device companies, collaboration is seen between Tier 2 system suppliers and Tier 3 components suppliers.

One such effort comes in the form of the BioPhorum Operations Group, a global collaboration comprising more than 90 Tier 1, 2 and 3 biopharmaceutical companies and suppliers; its purpose is to develop and share best practices for pharmaceutical and medical device manufacturing. For example, BioPhorum has succeeded in establishing effective testing methods for extractables and leachables to help the industry approve SUS for safe and effective use.

To select processing materials that avoid risk, its important to understand the chemical nature of extractables, which are compounds emitted from a packaging component, delivery system, or manufacturing surface during aggressive testing; and leachables, which are compounds that migrate into the drug over time from contact with the system componentry and manufacturing surfaces.

To assist suppliers with their evaluation of SUS extractables, the BioPhorum team developed testing protocols based on a set of solvents and immersion times. Adhering to such protocols helps ensure the successful use of SUS for biopharmaceutical manufacturing, though the final responsibility for confirming the safety and efficacy of the therapeutic remains that of the Tier 1 pharmaceutical companies and medical device makers, not their suppliers.

Complementing the BioPhorum extractables protocol is a best practice guide for evaluating SUS leachables. BioPhorum protocol applies to SUS components that contact the pharmaceutical product or process fluids, including but not limited to the medical device/drug delivery market:

Note: The standardized extractables testing protocol does not cover final container closure systems.

Achieving medical-grade system components requires treating the part as a medical product when it comes to cleanroom and manufacturing practices. For tubing, for example, its no longer acceptable to manufacture medical-device-grade tubing on the production floor and then attempt to sterilize it. Tubing production for any medical device must take place in ISO certified cleanrooms that adhere to FDA's Current Good Manufacturing Practices governing particulates, air pressure, and personnel practices to ensure that products meet tolerance and cleanliness requirements. This may require bioburden and endotoxin testing.

These procedures help ensure production of safe, validated products in critical areas such as the transfer of monoclonal antibodies, laboratory-produced base media for therapeutics engineered to represent the bodys immunes system and used in the development of cancer-treating therapeutics. The tubing must be bacteria-free and remain strong as it transfers the monoclonal antibodies to the bioreactor and chromatography equipment, where wanted therapeutics are filtered out.

Other single-use tubing applications include peristaltic pumps with rotating wheels that push the fluid through tubes. To withstand the rigors of the pumping process and ensure that the tubing walls remain intact, high-strength tubing is required.

Advancements in therapeutics will continue driving the development and growth of SUS and their components. One such advancementchimeric antigen receptor (CAR T) cell therapy under development by Kite, a Gilead Companytaps into the potential of personalized medicine for cancer treatments, using the patients immune system to target and attack tumors.

T-cells, a white blood cell developed from stem cells in the bone marrow, help the body to fight cancer and infections. Currently, three FDA-approved CAR T cell therapies, developed by Gilead and Novartis, are available. There is also exponential growth of other biotechnology and pharmaceutical companies actively advancing cellular immunotherapies through clinical trials.

Investigational for now, the safety and efficacy of T-cell therapy is an active area of research, and it could prove to be a game-changer. A cancer patients blood is collected and purified to select the T-cells, which are activated and expanded within the lab and transfected to express a chimeric antigen receptor, or synthetic T-cell receptor, targeting a specific tumor antigen. The T-cells grow and expand for two weeks and are then infused back into the patient where the engineered cells attack the tumors. This chain of events requires a precise timeline with all components of the process being sterile and having passed stringent testing for quality and reliability.

Unlocking the immune system to effectively fight cancer is truly exciting and serves as a great illustration of the potential medical device use of SUS in biopharmaceutical processing.

Continue reading here:
Onward and Upward for Single-Use Systems in Bioprocessing - Medical Device and Diagnostics Industry

To Read More: Onward and Upward for Single-Use Systems in Bioprocessing – Medical Device and Diagnostics Industry
categoriaBone Marrow Stem Cells commentoComments Off on Onward and Upward for Single-Use Systems in Bioprocessing – Medical Device and Diagnostics Industry | dataJanuary 27th, 2021
Read All

From Kochi, with love – Stem cell donor meets infant survivor after two years – The New Indian Express

By daniellenierenberg

Express News Service

KOCHI:How would a two-year-old child react when she meets her lifes saviour in real life? It is quite hard to imagine. Or from the other side, the reaction of the person who sees, after two years, the face of the infant he rescued from certain death.

At times, emotions just abound, beyond what words can express! Tears of joy rolled down Amir's face, when he first met two-year-old Vihaa Khanekar, to whom he had donated his blood stem cells in 2019, on Saturday.

The four-hour-long video call that Amir made to Vihaa and her family members late on Saturday made him make up his mind to fly to Pune soon to meet Vihaa. A Pune resident, Vihaa was diagnosed with Juvenile Myelomonocytic Leukemia (JML), when she was barely four-and-a-half months' old. Bone marrow transplant was the only hope and her parents were devastated.

"When we first heard the news it was as if we were hit by a hailstorm. It was known that our daughters condition was a rare one and that it was difficult for her to get a transplant. Her father swooned and even her mother almost had a blackout. The whole family came together to support them," said Dnyaneshwar Khanekar, Vihaas grandfather.

Vihaa received the cells in September 2019. "She was diagnosed with the illness in March. It is Amir who saved her life. In 2018, Amir had registered with the DATRI-Blood Stem Donors Registry in Aluva. His blood stem cells were a match and Amir was happy to donate them,"said Aby Sam John, DATRI Kerala- Maharastra Regional head.

26-year-old Amir Suhail Hussain, a resident of Nedumbassery, is not only happy about saving a life, but he also urged like-minded people to come forward. "When I came to know about Vihaa, I had no hesitation. However, my kin, particularly my parents, were anxious, more so because they were ignorant about the whole process. After assurances from doctors, they came to terms with my decision," said Amir.

According to Vihaas parents, her condition is better, with no complications. The transplant took place at a private hospital in Pune. "Though Amir is not known to us, his generosity has overwhelmed us," said Sandeep Khanekar, Vihaa's father.

The Saviour and Survivor meet was held by DATRI as part of creating awareness among many about donating stem cells and saving lives. The meet was organised virtually. DATRI - Indias largest blood stem cell donor registry - has 4,61,627 donors registered. A total of 773 people have donated their blood stem cells.

Read this article:
From Kochi, with love - Stem cell donor meets infant survivor after two years - The New Indian Express

To Read More: From Kochi, with love – Stem cell donor meets infant survivor after two years – The New Indian Express
categoriaBone Marrow Stem Cells commentoComments Off on From Kochi, with love – Stem cell donor meets infant survivor after two years – The New Indian Express | dataJanuary 25th, 2021
Read All

Stem Cell Therapy Market Size, Growth Opportunities, Trends, Key Players and Forecast to 2027 – The Courier

By daniellenierenberg

Request Download SampleAsk For Discount Company Profile

New Jersey, United States,- Stem Cell Therapy Market Report gives a detailed analysis of the market. After a detailed examination of the current trends, the report shares the details around the factors fueling the markets momentum.

Forgiving an in-depth review of the market, the report showcases the factors that are affecting the markets overall growth. From network partners, production methods to revenue generating techniques, every detail is added in the report. In addition, the Stem Cell Therapy report has enclosed the data about the established players of the market.

Stem Cell Therapy report has a dedicated section that highlights the actions that can be appointed for global level expansion. The report is designed to guide through every step from planning till implementation.

The major players covered in the Stem Cell Therapy market are

Osiris Therapeutics Medipost Co. Ltd. Anterogen Co. Ltd. Pharmicell Co. Ltd. HolostemTerapieAvanzateSrl JCR Pharmaceuticals Co. Ltd. Nuvasive RTI Surgical Allosource

It is worth noting that the Stem Cell Therapy market report also gives a complete overview in terms of volume, market value, demand and supply. All these factors add up to become the market dynamics of the Stem Cell Therapy market. For leaping ahead of the competition and to make the most out of the emerging opportunities, it is essential to understand the market dynamics.

As per the Verified Market Reports experts, the Stem Cell Therapy market is going to balloon in terms of revenue and customer base. This conclusion was drawn out from the market indicators that are considered in the Stem Cell Therapy market report to form curated data. The crucial pieces of data are included in the form of tables, charts and graphs to give a visual representation of the complex and huge database.

What key insights does the Stem Cell Therapy market research provide?

Past and current revenue statistics of the Stem Cell Therapy market players analyzed at the regional level. Individual profiling of major stakeholders. Analysis of the Stem Cell Therapy market size on the basis of product type and end-use type. Accurate Stem Cell Therapy market forecast of volume in numbers and percentages. Demand prospect of individual segments covered in the Stem Cell Therapy report.

Segmentation of Stem Cell Therapy Market:

1.Stem Cell Therapy Market, By Cell Source:

Adipose Tissue-Derived Mesenchymal Stem Cells Bone Marrow-Derived Mesenchymal Stem Cells Cord Blood/Embryonic Stem Cells Other Cell Sources

2.Stem Cell Therapy Market, By Therapeutic Application:

Musculoskeletal Disorders Wounds and Injuries Cardiovascular Diseases Surgeries Gastrointestinal Diseases Other Applications

3.Stem Cell Therapy Market, By Type:

Allogeneic Stem Cell Therapy Market, By Application Musculoskeletal Disorders Wounds and Injuries Surgeries Acute Graft-Versus-Host Disease (AGVHD) Other Applications Autologous Stem Cell Therapy Market, By Application Cardiovascular Diseases Wounds and Injuries Gastrointestinal Diseases Other Applications

Stem Cell Therapy Market Report Scope

What queries are resolved by the Stem Cell Therapy market research?

1. What are the restraints slowing down the progress of Stem Cell Therapy market?2. Why are the end consumers getting more inclined towards alternative Stem Cell Therapy market products?3. How the Stem Cell Therapy market expected to shape in the next septennial?4. What strategies are being appointed by the major players of the Stem Cell Therapy market to stay ahead of the competition?5. What innovative technologies are being used by the established players of the Stem Cell Therapy market to stay ahead of the competition?

Why choose Verified Market Reports?

Smart dashboard to provide details about updated industry trends. Data collection from different network partners such as suppliers, vendors, service providers, for giving out a clear perspective of the Stem Cell Therapy market. Strict quality checking standards Data collection, triangulation, and validation. 24/7 at your service.

Visualize Stem Cell Therapy Market using Verified Market Intelligence:-

Verified Market Intelligence is our BI enabled platform for narrative storytelling of this market. VMI offers in-depth forecasted trends and accurate Insights on over 20,000+ emerging & niche markets, helping you make critical revenue impacting decisions for a brilliant future.

VMI provides a holistic overview and global competitive landscape with respect to Region, Country, and Segment and Key players of your market. Present your Market Report & findings with inbuilt presentation feature saving over 70% of your time and resources for Investor, Sales & Marketing, R&D and Product Development pitches. VMI enables data delivery In Excel and Interactive PDF formats with over 15+ Key Market Indicators for your market.

About Us: Verified Market Reports

Verified Market Reports is a leading Global Research and Consulting firm servicing over 5000+ global clients. We provide advanced analytical research solutions while offering information enriched research studies.

We also offer insights into strategic and growth analyses and data necessary to achieve corporate goals and critical revenue decisions.

Our 250 Analysts and SMEs offer a high level of expertise in data collection and governance using industrial techniques to collect and analyse data on more than 25,000 high impact and niche markets. Our analysts are trained to combine modern data collection techniques, superior research methodology, expertise, and years of collective experience to produce informative and accurate research.

Our research spans over a multitude of industries including Energy, Technology, Manufacturing and Construction, Chemicals and Materials, Food and Beverages etc. Having serviced many Fortune 2000 organizations, we bring a rich and reliable experience that covers all kinds of research needs.

Contact us:

Mr. Edwyne Fernandes

US: +1 (650)-781-4080UK: +44 (753)-715-0008APAC: +61 (488)-85-9400US Toll-Free: +1 (800)-782-1768

Email: sales@verifiedmarketreports.com

Website: https://www.verifiedmarketreports.com/

Link:
Stem Cell Therapy Market Size, Growth Opportunities, Trends, Key Players and Forecast to 2027 - The Courier

To Read More: Stem Cell Therapy Market Size, Growth Opportunities, Trends, Key Players and Forecast to 2027 – The Courier
categoriaBone Marrow Stem Cells commentoComments Off on Stem Cell Therapy Market Size, Growth Opportunities, Trends, Key Players and Forecast to 2027 – The Courier | dataJanuary 23rd, 2021
Read All

Global Cell Isolation Market SWOT Analysis, Key Indicators, Forecast 2027 : Becton, Dickinson, and Company, Thermo Fisher Scientific KSU | The…

By daniellenierenberg

The market research report titled Cell Isolation Market by Product (Instruments and Consumables), by Cell Type (Animal and Human), by Cell Source (Adipose Tissue, Embryonic/Cord Blood Stem Cells, and Bone Marrow), by Technique (Surface Marker-Based Cell Isolation, Centrifugation-Based Cell Isolation, and Filtration-Based Cell Isolation), by Application (Cancer Research, Biomolecule Isolation, Tissue Regeneration & Regenerative Medicine, Stem Cell Research, In Vitro Diagnostics, and Others), and By End-User (Hospitals & Diagnostic Laboratories, Research Laboratories & Institutes, Biotechnology & Biopharmaceutical Companies, and Others): Global Industry Perspective, Comprehensive Analysis, and Forecast, 20182025 published by Zion Market Research provides an insightful comprehension about the growth aspects, dynamics, and working of the globalCell IsolationMarket. The report entails details about the market with data collected over the years with its wide-ranging analysis. It also comprises the competitive landscape within the market together with a detailed evaluation of the leading players within the global Cell Isolation Market. In addition, it sheds light on the profiles of the key vendors/manufacturers comprising thorough assessment of the market share, production technology, market entry strategies, revenue forecasts, and so on. Further, the report will encompass the fundamental strategic activities such as product developments, mergers & acquisitions, launches, events, partnerships, collaborations, and so on. Apart from this, it will also present the new entrants contributing their part in the market growth.

FREE | Request Sample is Available @https://www.zionmarketresearch.com/sample/cell-isolation-market

Global Cell Isolation Market: Competitive Players

Becton, Dickinson, and Company, Thermo Fisher Scientific, Inc., Merck KGaA, Beckman Coulter Inc., Terumo BCT, Bio-Rad Laboratories, Inc.

The Cell Isolation Market report also entails exhaustive examination of the key factors likely to propel or restrict the expansion of the global Cell Isolation Market during the forecast period in addition to the most recent and promising future trends in the market. Moreover, the report uses SWOT analysis and other methodologies to analyze the numerous segments [Product, Applications, End-Users, and Major Regions] of the global Cell Isolation Market. Furthermore, it comprises valuable understanding about the segments like their growth potential, market share, and developments. It also evaluates the market on the basis of its major geographical regions [Latin America, North America, Asia Pacific, Middle & East Africa, and Europe]. It entails quantitative and qualitative facets of the market in association to each country and region enlisted in the report.

Promising Regions & Countries Mentioned In The Cell Isolation Market Report:

Download Free PDF Report Brochure @https://www.zionmarketresearch.com/requestbrochure/cell-isolation-market

The Cell Isolation Market report also stipulates the computed expected CAGR of the market estimated on the basis of the existing and previous records concerning the global Cell Isolation Market. The report analyzes the market with the aim of being capable to get a clear picture of prevailing and anticipated growth patterns of the market. Furthermore, it entails the impact of numerous federal policies and rules on the growth and dynamics of the market during the forecast period. The thorough assessment put forth by our analysts assist to get more profound acquaintance of global markets and related industries. In addition, the report encompasses various tactics to discover the weaknesses, opportunities, risks, and strengths having the potential to impact the global market expansion.

Impact of COVID-19 (Coronavirus):The report will also entail a dedicated section assessing the influence of COVID-19 on the expansion of the global Cell Isolation Market during the coming period.

Report Customization:Clients can request for customization of report as per their need for additional data.

Apart from this, our team will be accessible around the clock to our clients for any kind of assistance.

Inquire more about this report @https://www.zionmarketresearch.com/inquiry/cell-isolation-market

Key Details & USPs of the Existing Report Study:

Request coronavirus impact analysis on sectors and market

Request Report TOC (Table of Contents) @https://www.zionmarketresearch.com/toc/cell-isolation-market

What Reports Provides

Also, Research Report Examines:

Thanks for reading this article;you can also get individual chapter wise section or region wise report version like North America, Europe or Asia.

See more here:
Global Cell Isolation Market SWOT Analysis, Key Indicators, Forecast 2027 : Becton, Dickinson, and Company, Thermo Fisher Scientific KSU | The...

To Read More: Global Cell Isolation Market SWOT Analysis, Key Indicators, Forecast 2027 : Becton, Dickinson, and Company, Thermo Fisher Scientific KSU | The…
categoriaBone Marrow Stem Cells commentoComments Off on Global Cell Isolation Market SWOT Analysis, Key Indicators, Forecast 2027 : Becton, Dickinson, and Company, Thermo Fisher Scientific KSU | The… | dataJanuary 23rd, 2021
Read All

Adipose Derived Stem Cell Therapy Market 2018: Production, Sales, Supply, Demand, Analysis and Forecast To 2026 | BioRestorative Therapies, Inc.,…

By daniellenierenberg

The Global Adipose Derived Stem Cell Therapy Market report provides a holistic evaluation of the market for the forecast period (20192025). The report comprises various segments as well as an analysis of the trends and factors that are playing a substantial role in the market. These factors; the market dynamics involve the drivers, restraints, opportunities and challenges through which the impact of these factors in the market are outlined. The drivers and restraints are intrinsic factors whereas opportunities and challenges are extrinsic factors of the market. The Global Adipose Derived Stem Cell Therapy Market study provides an outlook on the development of the market in terms of revenue throughout the prognosis period.

In order to present an executive-level model of the market and its future perspectives, the Adipose Derived Stem Cell Therapy Market report presents a clear segmentation based on different parameters. The factors that affect these segments are also discussed in detail in the report.

Adipose derived stem cells (ADSCs) are stem cells derived from adipocytes, and can differentiate into variety of cell types. ADSCs have multipotency similar to bone marrow mesenchymal stem cells, thus ADSCs substitute for bone marrow as a source of stem cells. Numerous manual and automatic stem cell separation procedures are adopted in order to separate adipose stem cells (ASCs) from adipose tissue. Flow cytometry can also be used to isolate ADSCs from other stem cells within a cell solution.

Major Players included in this report are as follows BioRestorative Therapies, Inc., Celltex Therapeutics Corporation, Antria, Inc., Cytori Therapeutics Inc., Intrexon Corporation, Mesoblast Ltd., iXCells Biotechnologies, Pluristem Therapeutics, Inc., Thermo Fisher Scientific, Inc., Tissue Genesis, Inc., Cyagen US Inc., Celprogen, Inc., and Lonza Group, among others.

Get PDF Brochure Of This Research Report @ https://www.coherentmarketinsights.com/insight/request-pdf/2357

Adipose Derived Stem Cell Therapy Market: Regional analysis includes:

The study will also feature the key companies operating in the industry, their product/business portfolio, market share, financial status, regional share, segment revenue, SWOT analysis, key strategies including mergers & acquisitions, product developments, joint ventures & partnerships an expansions among others, and their latest news as well. The study will also provide a list of emerging players in the Adipose Derived Stem Cell Therapy Market.

Adipose Derived Stem Cell Therapy Market scope

A basic summary of the competitive landscape A detailed breakdown of the regional expanse A short overview of the segmentation

Furthermore, this study will help our clients solve the following issues:

Cyclical dynamics We foresee dynamics of industries by using core analytical and unconventional market research approaches. Our clients use insights provided by us to maneuver themselves through market uncertainties and disruptions.

Identifying key cannibalizes Strong substitute of a product or service is the most prominent threat. Our clients can identify key cannibalizes of a market, by procuring our research. This helps them in aligning their new product development/launch strategies in advance.

Spotting emerging trends Our Ecosystem offering helps the client to spot upcoming hot market trends. We also track possible impact and disruptions which a market would witness by a particular emerging trend. Our proactive analysis helps clients to have an early mover advantage.

Interrelated opportunities This report will allow clients to make decisions based on data, thereby increasing the chances that the strategies will perform better if not best in the real world.

Request Sample Copy of Research Report @ https://www.coherentmarketinsights.com/insight/request-sample/2357

Some of the Major Highlights of TOC covers:

Adipose Derived Stem Cell Therapy Regional Market Analysis

Adipose Derived Stem Cell Therapy Production by Regions Global Adipose Derived Stem Cell Therapy Production by Regions Global Adipose Derived Stem Cell Therapy Revenue by Regions Adipose Derived Stem Cell Therapy Consumption by Regions

Adipose Derived Stem Cell Therapy Segment Market Analysis (by Type)

Global Adipose Derived Stem Cell Therapy Production by Type Global Adipose Derived Stem Cell Therapy Revenue by Type Adipose Derived Stem Cell Therapy Price by Type

Adipose Derived Stem Cell Therapy Segment Market Analysis (by Application)

Global Adipose Derived Stem Cell Therapy Consumption by Application Global Adipose Derived Stem Cell Therapy Consumption Market Share by Application (2014-2019)

Adipose Derived Stem Cell Therapy Major Manufacturers Analysis

Adipose Derived Stem Cell Therapy Production Sites and Area Served Product Introduction, Application and Specification Adipose Derived Stem Cell Therapy Production, Revenue, Ex-factory Price and Gross Margin (2014-2019)Main Business and Markets Served

Key questions answered in the report:

LIMITED TIME OFFER Hurry Up!

Get Discount For Buyers UPTO 30% OFF On Any Research Report

Apply Promo Code CMIFIRST1000 And Get Instant Discount Of USD 1000

Ask For Discount Before Purchasing This Business Report @ https://www.coherentmarketinsights.com/insight/request-discount/2357

Key Benefits

Major countries in each region are mapped according to individual market revenue. Comprehensive analysis of factors that drive and restrict market growth is provided. The report includes an in-depth analysis of current research and clinical developments within the market. Key players and their key developments in recent years are listed.And More.

About Coherent Market Insights

Coherent Market Insights is a prominent market research and consulting firm offering action-ready syndicated research reports, custom market analysis, consulting services, and competitive analysis through various recommendations related to emerging market trends, technologies, and potential absolute dollar opportunity.

Contact Us

Mr. ShahCoherent Market Insights1001 4th Ave, #3200Seattle, WA 98154Tel: +1-206-701-6702Email: sales@coherentmarketinsights.com

Originally posted here:
Adipose Derived Stem Cell Therapy Market 2018: Production, Sales, Supply, Demand, Analysis and Forecast To 2026 | BioRestorative Therapies, Inc.,...

To Read More: Adipose Derived Stem Cell Therapy Market 2018: Production, Sales, Supply, Demand, Analysis and Forecast To 2026 | BioRestorative Therapies, Inc.,…
categoriaBone Marrow Stem Cells commentoComments Off on Adipose Derived Stem Cell Therapy Market 2018: Production, Sales, Supply, Demand, Analysis and Forecast To 2026 | BioRestorative Therapies, Inc.,… | dataJanuary 23rd, 2021
Read All

‘I was excited to help somebody’: Montana Western’s Dylan Pope reflects on donating bone marrow – MontanaSports

By daniellenierenberg

DILLON Dylan Pope concurs that 2020 was, by and large, not a great year. But he still found a way to make the most of it.

"It was a pretty tough year but having this to look forward to and reflect on has been something pretty big for me," he said.

Pope, a Montana Western defensive back, made the decision to donate bone marrow in December.

"I was nervous, but I was excited to help somebody," Pope said.

At the encouragement of his sister, Mariah, Pope registered with a non-profit called Be The Match in March, shortly after coronavirus knocked the world off kilter.

According to the organization's website, only one out of every 430 registered members will actually go on to donate bone marrow. Pope's sister has been registered for years without a match.

So, Pope was understandably taken aback when, after a little more than three months, he received a call telling him that he had been deemed a suitable donor for an anonymous recipient to receive his blood stem cells, which are derived from bone marrow.

"At first I thought it was fake," Pope said. "I didn't think there was any way it was going to happen after just three months."

With a donation date set in December -- because of confidentiality policies, Pope can't disclose what state or hospital the procedure took place at -- the next months were what one would expect: a lot of paperwork and a lot of blood tests.

The week before the donation, he began receiving daily injections to increase his stem cell count. He then made the trip with his younger brother, Brayton.

The process took eight hours and required only local anesthesia. A needle in his right arm drew blood, ran it through a machine that extracted stem cells and then a needle in his left arm injected blood back into his body.

"It's really not nearly as scary when you get there as you think it's going to be," Pope said.

It'll be a year before Pope learns the identity of who received his bone marrow. He's certain it'll be a moving, powerful experience.

"I bet it'll be pretty emotional thing for both of us, because it was pretty cool to be able to help them," Pope said.

Ryan Nourse, Montana Western's head football coach, said he wasn't surprised by Pope's willingness to donate bone marrow and said he and the program supported him the entire way.

"I think that's a really brave thing, courageous thing for Dylan to go do," Nourse said. "I think that selflessness will shine through to the other guys knowing that maybe I could help somebody in a similar position someday."

More here:
'I was excited to help somebody': Montana Western's Dylan Pope reflects on donating bone marrow - MontanaSports

To Read More: ‘I was excited to help somebody’: Montana Western’s Dylan Pope reflects on donating bone marrow – MontanaSports
categoriaBone Marrow Stem Cells commentoComments Off on ‘I was excited to help somebody’: Montana Western’s Dylan Pope reflects on donating bone marrow – MontanaSports | dataJanuary 22nd, 2021
Read All

Global Bone Marrow-Derived Stem Cells (BMSCS) Market 2021 Overview, Trends, Growth Factors and Leading Players With Detailed Analysis of Industry…

By daniellenierenberg

By providing an absolute overview of the market, Global Bone Marrow-Derived Stem Cells (BMSCS) Market report covers various aspects of market analysis, product definition, market segmentation, key developments, and the existing vendor landscape. Such market insights can be accomplished with this comprehensive Global Bone Marrow-Derived Stem Cells (BMSCS) Market research report which takes into account all the aspects of current and future market. The report provides wide-ranging analysis of the market structure along with the estimations of the various segments and sub-segments of the market. This Global Bone Marrow-Derived Stem Cells (BMSCS) Market research report delivers an analytical measurement of the main challenges faced bythe business currently and in the upcoming years.

Bone marrow-derivedstem cells(BMSCS) market is expected to gain market growth in the forecast period of 2020 to 2027. Data Bridge Market Research analyses the market to growing at a CAGR of 10.4% in the above-mentioned forecast period. Increasing awareness regarding the benefits associates with the preservation of bone marrow derived stem cells will boost the growth of the market.

Get Sample Report + All Related Graphs & Charts @https://www.databridgemarketresearch.com/request-a-sample/?dbmr=global-bone-marrow-derived-stem-cells-bmscs-market

The major players covered in the bone marrow-derived stem cells (BMSCS) market report are CBR Systems, Inc, Cordlife Sciences India Pvt. Ltd., Cryo-Cell International, Inc.ESPERITE N.V., LifeCell International Pvt. Ltd., StemCyte India Therapeutics Pvt. Ltd, PerkinElmer Inc, Global Cord Blood Corporation., Smart Cells International Ltd., Vita 34 among other domestic and global players.

Some of the factors such as introduction of novel technologies for the preservation of stem cells and their storage, surging investment that will help in research activities leading to stem cells benefits, adoption of hemotopoietic stem cell transplantation system will accelerate the growth of the bone marrow-derived stem cells (BMSCS) market in the forecast period of 2020-2027. Various factors that will create opportunities in the bone marrow-derived stem cells (BMSCS) market are increasing occurrences of various diseases along with rising applications in emerging economies.

Large cost of operation and strict regulatory framework will restrict the growth of bone marrow-derived stem cells (BMSCS) market in the above mentioned forecast period. Ethical concern leading to stem cells will become the biggest challenge in the market growth.

Global Bone Marrow-Derived Stem Cells (BMSCS) Market By Service Type (Sample Preservation and Storage, Sample Analysis, Sample Processing, Sample Collection and Transportation), Application (Personalized Banking Applications, Research Applications, Clinical Applications), Country (U.S., Canada, Mexico, Germany, Italy, U.K., France, Spain, Netherland, Belgium, Switzerland, Turkey, Russia, Rest of Europe, Japan, China, India, South Korea, Australia, Singapore, Malaysia, Thailand, Indonesia, Philippines, Rest of Asia- Pacific, Brazil, Argentina, Rest of South America, South Africa, Saudi Arabia, UAE, Egypt, Israel, Rest of Middle East & Africa), Market Trends and Forecast to 2027

Global Bone Marrow-Derived Stem Cells (BMSCS) Market Scope and Market Size

Bone marrow-derivedstem cells(BMSCS) market is segmented on the basis of service type and application. The growth amongst these segments will help you analyse meagre growth segments in the industries, and provide the users with valuable market overview and market insights to help them in making strategic decisions for identification of core market applications.

Thisbonemarrow-derived stem cells (BMSCS) market report provides details of new recent developments, trade regulations, import export analysis, production analysis, value chain optimization, market share, impact of domestic and localised market players, analyses opportunities in terms of emerging revenue pockets, changes in market regulations, strategic market growth analysis, market size, category market growths, application niches and dominance, product approvals, product launches, geographic expansions, technological innovations in the market. To gain more info on bone marrow-derived stem cells (BMSCS) market contactData Bridge Market Researchfor anAnalyst Brief, our team will help you take an informed market decision to achieve market growth.

Grab Your Report at an Impressive 30% Discount! Please click Here @

https://www.databridgemarketresearch.com/inquire-before-buying/?dbmr=global-bone-marrow-derived-stem-cells-bmscs-market

Bone Marrow-Derived Stem Cells (BMSCS) Market Country Level Analysis

Bone marrow-derivedstem cells(BMSCS) market is analysed and market size insights and trends are provided by country, service type and application as referenced above.

The country section of the bone marrow-derivedstem cells(BMSCS) market report also provides individual market impacting factors and changes in regulation in the market domestically that impacts the current and future trends of the market. Data points such as consumption volumes, production sites and volumes, import export analysis, price trend analysis, cost of raw materials, down-stream and upstream value chain analysis are some of the major pointers used to forecast the market scenario for individual countries. Also, presence and availability of global brands and their challenges faced due to large or scarce competition from local and domestic brands, impact of domestic tariffs and trade routes are considered while providing forecast analysis of the country data.

Healthcare Infrastructure Growth Installed Base and New Technology Penetration

Bone marrow-derived stem cells (BMSCS) market also provides you with detailed market analysis for every country growth in healthcare expenditure for capital equipments, installed base of different kind of products for bone marrow-derived stem cells (BMSCS) market, impact of technology using life line curves and changes in healthcare regulatory scenarios and their impact on the bone marrow-derived stem cells (BMSCS) market. The data is available for historic period 2010 to 2018.

For More Insights Get Detailed TOC @ https://www.databridgemarketresearch.com/toc/?dbmr=global-bone-marrow-derived-stem-cells-bmscs-market

Key Highlights of Report

Competitive Landscape and Bone Marrow-Derived Stem Cells (BMSCS) Market Share Analysis

Bone marrow-derived stem cells (BMSCS) market competitive landscape provides details by competitor. Details included are company overview, company financials, revenue generated, market potential, investment in research and development, new market initiatives, global presence, production sites and facilities, production capacities, company strengths and weaknesses, product launch, product width and breadth, application dominance. The above data points provided are only related to the companies focus related to bone marrow-derived stem cells (BMSCS) market.

About Data Bridge Market Research:

Data Bridge Market Researchset forth itself as an unconventional and neoteric Market research and consulting firm with unparalleled level of resilience and integrated approaches. We are determined to unearth the best market opportunities and foster efficient information for your business to thrive in the market. Data Bridge endeavors to provide appropriate solutions to the complex business challenges and initiates an effortless decision-making process.

Contact:

Data Bridge Market Research

US: +1 888 387 2818

UK: +44 208 089 1725

Hong Kong: +852 8192 7475

Email:Corporatesales@databridgemarketresearch.com

Read the original:
Global Bone Marrow-Derived Stem Cells (BMSCS) Market 2021 Overview, Trends, Growth Factors and Leading Players With Detailed Analysis of Industry...

To Read More: Global Bone Marrow-Derived Stem Cells (BMSCS) Market 2021 Overview, Trends, Growth Factors and Leading Players With Detailed Analysis of Industry…
categoriaBone Marrow Stem Cells commentoComments Off on Global Bone Marrow-Derived Stem Cells (BMSCS) Market 2021 Overview, Trends, Growth Factors and Leading Players With Detailed Analysis of Industry… | dataJanuary 22nd, 2021
Read All

Brave Evie Hodgson from Sleights finally has bone marrow transplant after one last ‘twist in the tale’ – Yorkshire Live

By daniellenierenberg

Brave youngster Evie Hodgson has finally undergone a life-saving bone marrow transplant after one last "twist in the tale" saw the delivery of the stem cells delayed.

Evie, eight, from Sleights near Whitby, began preparations for the transplant earlier this year and has now finally been given the "magic stem cells".

It's not been an easy journey for Evie and her family, who were devastated in August 2020 when a potential donor pulled out at the last minute, and they faced another sudden bump in the road prior to her receiving her first round of treatment today (Friday).

The operation for the eight-year-old was scheduled for 2pm yesterday (Thursday) at The Great Northern Children's Hospital in Newcastle but the cells got stuck in London after coronavirus "caused major issues to the flight schedule".

It meant that Evie and her family had to wait another day for the operation to go ahead, but her mother Tina gave an update today to say that they were "up and running" after what had been an "emotional experience".

She said earlier today: "We have fought so hard to get to this point and Evie is so happy. It really is wonderful.

"Evie's hero donated a phenomenal amount of stem cells so she gets two sittings. The second one will be around dinner time so she gets to do it all again."

The courageous pupil at Fyling Hall School, in Robin Hood's Bay, was diagnosed with aplastic anaemia, also known as bone marrow failure, last year during the start of the covid-19 pandemic.

The youngster captured the attention of the nation when her perfect donor pulled out at the last minute and her transplant hopes were dashed.

But Evie revealed it was " the best Christmas present ever" to find another donor in December.

The family have thanked everybody who has supported them, shared Evie's story and signed up to the stem cell register following their inspirational campaign.

You can join on the DKMS register, here, or through Anthony Nolan register, here.

A dedicated Facebook page has been set up to follow Evie's journey with aplastic anaemia, which you can follow here.

Here is the original post:
Brave Evie Hodgson from Sleights finally has bone marrow transplant after one last 'twist in the tale' - Yorkshire Live

To Read More: Brave Evie Hodgson from Sleights finally has bone marrow transplant after one last ‘twist in the tale’ – Yorkshire Live
categoriaBone Marrow Stem Cells commentoComments Off on Brave Evie Hodgson from Sleights finally has bone marrow transplant after one last ‘twist in the tale’ – Yorkshire Live | dataJanuary 22nd, 2021
Read All

Mesoblast Limited: Is Stemcell Therapy Ready For Prime Time? – Sick Economics

By daniellenierenberg

Mesoblast, MESO, is an Australian based biopharmaceutical company that has been a market favorite, even though the companys ups and downs have confused many investors.

The MESO share price has been inconsistent lately. This has prompted many investors to ask why. Analyzed carefully, MESO has done better than many stem cell businesses. Most stem cell businesses fail to ever make a profit and fail to even get a product to market. This can cause long-term problems with the stock price of any company.

ByMichael A. Mannen, MS

Mesoblast as a company is committed to offering groundbreaking cellular therapies for the treatment of many severe diseases using Mesenchymal Stem Cells. They are dedicated to cellular medicines and leveraging their stem cell technology. There are not many successful companies in this niche.

Adult stem cells are undifferentiated cells that divide and rebuild the damaged tissue. Mesenchymal Stem Cells are a type of adult stem cells generated from some of the adult tissues present in the body.

Stem cells have been found by scientists to have two properties: self-renewal and the potential to divide into specialized cell types. Multi-potent, mesenchymal stem cells are found to be present in many adult tissues. The bone marrow is considered by many scientists to be the most usable reservoir of adult human stem cells.

For several disorders, such as heart failure, the capacity to rebuild tissue may be groundbreaking for treatment. And this has been the inspiration for many companies exploring stem cell therapies.

However, what differentiates Mesoblast from other stem cell companies is its approach to treating inflammatory diseases. Their products have the potential to make breakthroughs a reality for many diseases.

The company has developed and manufactured its own patented mesenchymal lineage cells to be used for a range of ailments. These have a potential for the regeneration of tissues. These cells, however, secrete a number of biomolecules which can help the body heal more than just tissue damage. They may be important to supporting immune responses needed for recovery in many diseases.

Possible rejection of the patients immune system is the biggest problem with the use of stem cell therapies in heart diseases and other diseases. This can worsen many illnesses.

MESO does appear committed to the quality of its product. For MESO it is a question of the effectiveness and safety of their products. Its a long and winding road to provide adequate scientific proof when presenting breakthrough treatments to regulators. Many less reputable organizations have touted stem cells without doing the necessary scientific investigation or seeking the necessary regulatory approval. Mesoblast is trying to do things the right way. Committing to doing science the right way leads to a lot of inevitable ups and downs. This raises financial speculation and can lead to wild fluctuations in the stock price of any company.

A further significant advantage of some of Mesoblasts products is that they apparently can be administered to patients without needing donor matching. This increases their viability. Moreover, it allows for a wide spectrum of patients to be treated from their products. This gives them an advantage in comparison with other firms and should potentially allow them to increasingly gain a larger market share.

Of great interest to investors include the many clinical trial phase 3 products that Mesoblast has in its pipeline. These include MPC-06-ID, Remestemcel-L, and REVASCOR.

Remestemcel-L is a Mesoblast therapy that may theoretically have properties to help with the treatment of ventilator-dependent patients with COVID-19 patients. However, a clinical trial reported some concerns with the therapy meeting its primary endpoint. And it sent the stock down in December 2020. Obviously, there is a large demand for the treatment of complications linked to Covid-19, so this bad news disappointed investors.

However, another therapy has shown promise in the DREAM-HF Phase 3 for patients with chronic heart failure. Although the Revasacor did not stop heart failure, it did seem to deliver dramatic reductions in heart attacks and other negative cardiovascular events that plague heart failure patients.

Heart failure is a pathology that involves ones heart having trouble pumping. The condition impacts millions of people worldwide. In order to feed and maintain it working, the heart muscle depends on a continuous supply of oxygen rich blood. Having stem cell therapies is highly desirable to treat cardiovascular diseases. Hopefully, many Cardiovascular disorders can be treated with stem cell therapies in the future.

Other conditions such as hypertension and Coronary artery disease can help lead to heart failure. According to the Mayo Clinic, heart failure can cause significant health complications and lead to Liver and Kidney damage in patients.

Some scientists believe that Mesenchymal Stem Cells when used to treat cardiovascular diseases can preserve the myocardium by reducing the intensity of inflammation and supporting angiogenesis. Angiogenesis is a mechanism used by the body to create new blood vessels. Their low immunogenicity once more makes them a perfect treatment. This helps ensure that the immune system of the patient does not produce a negative response to the therapy. This theoretically can give stem cell therapies an advantage over some protein-based treatments that are easily recognized by the patients immune system.

This product could be a major development for Mesoblast moving forward, although further analysis and testing is still needed.

Stem cell therapies are not without experimental and medical challenges. For example, there are concerns with the ability of stem cell migration to tissues that require regeneration. There may also be cases whereby stem cells are divided into unintended cells. There may also be difficulties with the manufacturing and culturing of stem cells. Identification of Mesenchymal stem cells in cell populations can be problematic. From a scientific point of view, bone marrow derived Mesenchymal Stem Cells are known to be the best source for obtaining these cells in the human body.

Mesoblast has a wide range of advanced research programs related to different stem cell therapies. MPC-06-ID could potentially be a viable therapy for treating chronic low back pain attributable to degenerative disc disease.

These are products that consumers should be thrilled about.

The company has solid financials for a stem cell company and has a lot of cash on hand. The stock had a market cap of over 2 billion on 9/30/2020 and a 52-week high of 21.28. Lately the news surrounding the companys clinical trials has been a potpourri of both good and bad, so the share price has settled at around $9. It has a float of 93.7 million shares.

Mesoblast is a really exciting healthcare business. The business has made a commitment for the future. And it should be a stock that investors continue to follow.

Link:
Mesoblast Limited: Is Stemcell Therapy Ready For Prime Time? - Sick Economics

To Read More: Mesoblast Limited: Is Stemcell Therapy Ready For Prime Time? – Sick Economics
categoriaBone Marrow Stem Cells commentoComments Off on Mesoblast Limited: Is Stemcell Therapy Ready For Prime Time? – Sick Economics | dataJanuary 22nd, 2021
Read All

[Full text] Identification and Targeting of ThomsenFriedenreich and IL1RAP | OTT – Dove Medical Press

By daniellenierenberg

Introduction

Chronic myeloid leukemia (CML) is a hematological malignancy that develops when the 9;22 translocation in a single hematopoietic stem cell (HSC) results in the expression of BCR-ABL1 tyrosine kinase fusion protein. If left untreated, CML progresses over approximately 5 years, from relatively benign chronic phase to accelerated phase, and then to fatal blast crisis. The introduction of tyrosine kinase inhibitors (TKIs) specifically targeting the BCR-ABL1 fusion protein was a breakthrough in the management of CML, leading to a significant reduction in mortality and improved 5-year survival rates. However, despite the high annual acquisition costs of all the TKIs; first-, second-, and-third line TKIs1 induce only transient responses in the 10% to 15% of CML patients diagnosed in advanced phase, suboptimal responses in approximately 30% of CML patients during chronic phase (CP) cases that experience disease progression each year during, and only 1020% chance of successful treatment discontinuation due to disease persistence.2 Among the causes of disease persistence, studies have shown that CML leukemia stem cells (LSC) play a major role in inducing therapeutic resistance and disease progression because they are able to self-renew.3,4 These LSC a rare subset of immature cells residing in the bone marrow niche are protected from the action of TKI5 because these cells are normally quiescent and the TKIs are designed to target malignant blast cells that proliferate. That is why current strategies are not able to effectively eliminate the LSC or the disease.3 In CML, LSC are primitive cells expressing CD34+ CD38- with the 9;22 translocations, or the Philadelphia chromosome (Ph).6 However, these markers cannot distinguish the cancer hematopoietic cells from normal ones. Additionally, the BCR-ABL fusion gene encodes for an intracellular tyrosine kinase protein rather than a surface protein, calling for the need to identify unique surface biomarkers for efficient targeting of this cell population with subsequent eradication of the root of the disease.

In 2010, a single biomarker, Interleukin 1 receptor accessory protein (IL1RAP), was found to be up-regulated on the cell surface of BCR-ABL+ LSC. They were able to distinguish Ph+ from Ph- LSCs using IL1RAP.7 A polyclonal anti-human IL1RAP was generated that not only targeted the LSC population but also killed normal peripheral blood mononuclear cells, indicating that this marker was not specific to the LSC.7 Another characteristic cell surface marker has been investigated; ThomsenFriedenreich antigen (TF, or CD176) a tumor-associated carbohydrate epitope. The CD176 antigen was found to be expressed on the surface of various cancer-initiating cells, such as breast carcinomas,8 colorectal carcinomas,9 several leukemias,10 and other types of cancer, but was absent from almost all normal adult cell types.11 CD176 was also found to be expressed on the surface of CD34+ hematopoietic stem cells of the K562 erythroblastic leukemia cell line; a cell line derived from a CML patient. Being strongly expressed on the surface of cancer cells and virtually absent from normal tissues, CD176 was evaluated as a suitable target for cancer biotherapy8 with the development of an anti-CD176 antibody that induced apoptosis of leukemic cells.12

Using monoclonal antibodies (mAb) as a tool for cancer therapy still has its limitations. Patients who receive mAb therapy may develop drug resistance or fail to respond to treatment owing to the multiple signaling pathways involved in the pathogenesis of cancer and other diseases.13 Targeting more than one molecule has proven to circumvent the regulation of parallel pathways and avoid resistance to the treatment.14 Bi-specific antibodies (Bis-Ab) are antibodies that can recognize two different epitopes. They can redirect specific immune cells to the tumor cells to enhance tumor eradication, enable the simultaneous blocking of two different targets that have common signaling pathways, or interact with two different cell-surface antigens instead of one with subsequent boosting of the binding specificity.13 Thus, the identification of two surface markers specific to the cancer stem cells would be useful in characterizing and targeting CML stem cells, without affecting other blood cells.

In this study, we evaluated co-expression of IL1RAP, linked to BCR-ABL+ expression, and the CD176 antigen, carried on the hematopoietic stem cell marker CD34 molecule, in CML patients. We identified PBMCs co-expressing CD34, IL1RAP, and CD176 antigens using flow cytometry, a finding that allowed for subsequent separation and targeting of such cells from normal HSCs. A bi-specific antibody (TF/RAP), was generated in order to target the IL1RAP+ and CD176+ cell population among PBMCs in patients with CML. We used a flow-cytometry assay as a cell-based assay to measure the antibody binding capability of the TF/RAP Bis-Ab to the cell surface antigens. Our TF/RAP Bis-Ab, increased targeting of the IL1RAP+ and CD176+ cell population among CML PBMCs but not corresponding normal cells, using complement-dependent cytotoxicity assay (CDC). This novel TF/RAP Bis-Ab may provide a novel strategy for the eradication of CML stem cells.

Deidentified samples of peripheral blood from healthy volunteers were obtained from Gulf Coast Regional Blood Bank (Houston, TX, USA) after signing informed consent and used as reference samples. Deidentified samples of peripheral blood mononuclear cells (PBMCs) from consented patients with CML were obtained from Oncology Research Gundersen BioBank (https://www.gundersenhealth.org/research/biobank/, La Crosse, WI, USA). While the samples were de-identified, necessary CML patient characteristics were collected (Table 1). The collection and dissemination protocols for the samples are approved by The Gundersen Human Subjects Committee/Institutional Review Board (IRB) and are in full compliance with National Cancer Institute Best Practices for Biospecimen Resources. Because the de-identified samples were received through Biobanks and not through direct intervention/interaction with a research subject, the Tulane University Human Research Protection Office was notified and this study was classified by the IRB as exempt as the study did not meet the definition of human subjects research according to US Federal policy (HHS regulations, 45 CFR part 46, subpart A, also known as the Common Rule). The study was conducted in accordance with the Declaration of Helsinki.

Table 1 CML Patients Characteristics

HEK 293FT cell line (Invitrogen # R70007) was cultured in DMEM (Life Technologies, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, 100 g/mL streptomycin sulfate, and 4.0 mM L-glutamine (Gibco BRL products, Gaithersburg, MD), at 37C in a humidified 5% CO2 incubator. The KG1 cell line (ATCC #CCL-246) and transduced derivative cells were cultured in Iscoves Modified Dulbeccos Medium (Life technologies) supplemented with 20% FBS at 37C in a humidified 5% CO2 incubator. K562 cell line (ATCC# CCL-243) was maintained in RPMI-1640 (Life technologies) supplemented with 10% FBS, 100 U/mL penicillin, 100 g/mL streptomycin sulfate at 37C in a humidified 5% CO2 incubator.

The IL1RAP cDNA was PCR amplified from an expression plasmid containing Human IL-1RAcP/IL-1R3 Gene ORF cDNA (Sino biological Inc., HG10121-CM) using Clone Amp HiFi PCR Premix (Takara Bio USA, Inc.), and primers that included either a BamHI or an XhoI site (F-IL1RAP: acgggatccccaccaagcttggtaccatgac; R-IL1RAP: acgctcgagttatacatttttcaaagatg). The PCR fragment was gel extracted as above, sub-cloned into BamHI and XhoI sites in the pHRST-MPSV vector according to standard protocols and confirmed by restriction mapping and sequencing.

Transient production of lentiviral particles in adherent HEK293T was modified from previously described.15 Briefly, HEK293T cells were seeded in a T-75 flask, where we used 4.0 g of envelope plasmid pMPSV-VSV-G, 10.0 g packaging plasmid psPAX2, and 26 g transfer plasmid that has the gene of interest. In our case, the transfer plasmid is either the antibody plasmid or the control. The plasmids were mixed into 500 L 0.25 M CaCl2 (Sigma Aldrich, St. Louis, MO) and incubated at room temperature for 5 minutes, and then mixed with 500 L 2xHBS and briefly vortexed. The mixed transfection cocktail was then incubated for 3 minutes at room temperature, and added into the medium of the cells, and mixed gently to make an even distribution. After 16 hours of incubation, the medium was replaced with fresh medium and collected every 24 hours for 3 days. The conditioned medium that contained the vector virus was then pelleted for 10 minutes at 1500 g and passed through a 0.45-m filter to remove the cell debris, and then frozen at 80C for long-term storage, or used for the transduction of target cells.

Lentiviral transduction was done as previously described.1618 In brief, lentiviral supernatant was added to KG1 cells cultured in complete IMEM. After overnight incubation, the lentiviral vector was removed, and fresh media was added. After 48 hours, IL1RAP expression was demonstrated by flow cytometry using anti-Human IL-1 RAcP/IL-1 R3 PE-conjugated antibody (#FAB676P, R&D Systems, Minneapolis, MN).

The CH and CL constant domains in the pLM219 plasmids were amplified with 0.5 nM overlapping mutant primers (Table S1), Deep Vent Polymerase (New England Biolabs), and reaction buffer for forty cycles at 94C for 10 seconds, 60C for 45 seconds, and 72C for 2 minutes. Initial fragments were purified, combined, and used to amplify the entire heavy or light domains (Table S2). The mutated fragments were then gel purified and sub-cloned into their corresponding vectors using restriction enzymes according to standard protocols (Table S2). Sequences were then verified by restriction digestion and sequencing.

For antibody sequences towards CD176 (TF) and IL1RAP, the VH and VL domains from two clones with the most conserved amino acid sequences (TF Clone 1 and Clone 2 called TF1 and TF2 for CD176; Clone 4B6 and Clone 4G9 called RAPa and RAPb for IL1RAP, respectively) were chosen from published sequences.20,21 IL1RAP antibody was designed to target the extracellular membrane anchor-proximal region that comprises an amino acid primary sequence VPAPRYTVELAC within 10 to 15 amino acids of amino acid 361 of human ILR1AP (Gene bank accession Q9NPH3) while the TF antibody was designed to target the same Gal(13)GalNAc disaccharide epitope20 as the Bis-Ab. Variable domains (VD) were codon-optimized and synthesized (Gene Art, Invitrogen) to be compatible with 15 base pairs of homologous sequences on both the 3 and 5 ends of pLM2 recipient plasmid flanking the EcoRI restriction enzyme site.

The pLM2 expression vector was digested with EcoRI to generate a double-stranded break. An In-Fusion HD cloning kit (Clontech, Inc) was used to clone the VD regions of the antibodies between the leader and constant regions of the pLM2 vectors. The correct clones were identified by PCR and restriction mapping and then verified by sequencing.

Adherent HEK cells were transfected as above. A total of 14 g high-quality plasmid-DNA, 10% GFP plasmid for assessment of transfection efficiency, while the rest was heavy and light chain plasmid DNA combined at a ratio of 1:1. Six to 8 hours later, cells were gently washed once with PBS and fresh growth medium added. Sixteen hours post-transfection, the medium was replaced with DMEM supplemented with 5% FCS and incubated at 5% CO2 for 24 hours prior to the initial collection of antibody supernatant. A second collection was made after a further 24 hours.

Flow antibodies used were as follows: anti-TF/CD176 mAb mouse IgM (Glycotope, Berlin, Germany) targeting Gal1-3GalNAc epitope; FITC-conjugated anti-mouse IgM secondary antibody (-chain specific, #F9259; Sigma); PE-conjugated mouse anti-human IL-1 RAcP/IL-1 R3 monoclonal IgG1 antibody, epitope Ser21-Glu359 (#FAB676P, R&D Systems); APC-conjugated mouse anti-human CD34 monoclonal IgG1 antibody (#QBEnd10, FAB7227A-025, R&D Systems); APC-conjugated mouse antihuman IgG monoclonal antibody (Clone G18-145, mouse IgG1 , #550,931, BD Pharmingen).

LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (#L34957, Invitrogen); Vibrio Cholera Neuraminidase (VCN; Sigma Aldrich Inc), an enzyme used to expose the CD176 on the surface of expressing cells. Flow cytometric analyses were performed in a BD LSR Fortessa (BD Biosciences, USA) and flow cytometric cell sorting was done in a FACSAriaII (P0010) cell sorter (BD Biosciences, USA). The amount of bi-specific antibody bound to the receptors was calculated from the frequency of total IgG bound receptors.

Sorted cells were received in RPMI media and then fixed using the standard 3:1 methanol: acetic acid fixative. Standard procedures were used for FISH hybridization and washing.22 The BCR/ABL1 Plus translocation, dual fusion probe set (Cytocell Inc., Tarrytown, NY) was used. Slides were analyzed using Leica Biosystems Cyto Vision. FISH nomenclature was described according to the ISCN 2016.23

CD34+CD176+IL1RAP+ and CD34+CD176+IL1RAP- cells were sorted from PBMC samples derived from patients with CML. Cells (1 x 103) were plated in Metho Cult Express (#04437, Stem Cell Technologies, Vancouver, Canada) semi-solid media containing recombinant human IL-3, IL-6, G-CSF, GM-CSF, SCF, TPO and cultured for 2 weeks in a humidified atmosphere at 37C with 5% CO2. Fourteen days after plating, the number of colonies was counted by microscopy.24,25

The capacity to induce CDC was assessed essentially as has been described.2628 Briefly, target cells (1105 cells) were pre-incubated at 37C for 60 min with diluted antibodies. Human serum from human male AB (Sigma Aldrich) (20% v/v) was added to the cells as a source of complement and incubated at 37C for an additional 45 min. Cells were then put on ice and viability was determined by staining with LIVE/DEAD staining and detected using a FORTESSA flow cytometer (BD Biosciences). CDC activity was expressed as a percentage of lyses as determined from the increase in the percentage of cells stained positive with the LIVE/DEAD marker compared to the control samples. Cycloviolacin O2 (CyO2, 0.05nM), a pore-forming peptide, was used as a positive control because it kills cells with the similar mechanisms as CDC by causing pores in the cell membrane.

The capacity to induce CDC was assessed essentially as has been described.2628 Briefly, target cells (1105 cells) were pre-incubated at 37C for 60 min with diluted antibodies. Human serum from human male AB (Sigma Aldrich) (20% (v/v)) was added to the cells as a source of complement and incubated at 37C for an additional 45 min. Cells were then put on ice and viability was determined by staining with LIVE/DEAD staining and detected using a FORTESSA flow cytometer (BD Biosciences). CDC activity was expressed as a percentage of lyses as determined from the increase in the percentage of cells stained positive with the LIVE/DEAD marker compared to the control samples. Cycloviolacin O2 (CyO2, 0.05nM), a pore-forming peptide, was used as a positive control because it kills cells with the similar mechanisms as CDC by causing pores in the cell membrane.

We measured the production of the Bis-Ab by ELISA. Plates were initially coated with goat anti-Human IgG heavy chain antibody (Axell) and blocked with PBS containing 0.5% Tween 20 (Fisher), 10% FBS (FetalPlex Animal Serum Complex, GeminiBio, Cat#100-602), 4% whey protein (BiPRO, AGROPUR). Undiluted or diluted supernatant was added, including the standard curve samples (human IgG MAb 1.7B, kindly provided by Dr. James Robinson), and negative blocking buffer. After incubating at 37C for 60 min, the plates were washed. Then, goat anti-Human lambda antibody conjugated to HRP (Southern Biotech, Cat# 207005) was added at 1:300 in blocking buffer for 60 min and washed five times. A mixture of 0.1M Na Acetate (pH 6), peroxide, and TMB substrate were added. The reaction was terminated by adding 1M phosphoric acid, and the absorbance of each well was measured at 450 nm using a Synergy H1 microplate reader (BioTek).

For each experiment, more than three independent replicates were conducted, and the results were expressed as average standard deviation. Comparison of multiple groups was conducted using ANOVA-based Test and p< 0.05 (*) represented significances with statistical meaning. Calculation of the Kd was done using the equation % RO = [Ab]/([Ab]+Kd) 100%, where RO is the receptor occupancy, Ab is the concentration of antibody and Kd is the equilibrium dissociation constant.

In order to analyze the co-expression of CD176 and IL1RAP antigens on CD34+ cells, peripheral blood mononuclear cells from a normal volunteer (NPBMCs), patients with CML, and K562 cells were isolated and stained with anti-CD34, anti-CD176, and anti-IL1RAP monoclonal antibodies and analyzed by flow cytometry (Figure 1A). It has been previously established that these markers were not expressed on normal PBMCs nor on stem cells7,10 CD34+ cell expression ranged from an average 938% in CML samples versus 83.7% in K562 cells (Figure 1A, upper panel). Within the CD34+ cell population, CD176 and IL1RAP antigens were variably expressed in CML samples, ranging from 1.35% in CML-4 to over 50% in CML-1 (Figure 1A, lower panel), while CD176+ IL1RAP+ was detected in 78% of CD34 cells in K562 cells. Surprisingly, surface co-expression of CD176 and IL1RAP was not only detectable on CD34+ cells in patients with BCR-ABL positive CML but was also demonstrable in cells from a treated patient who was BCR-ABL negative (CML-2) (Figure 1B). In Figure 1C, CD34+ cells revealed higher frequency of CD176+ IL1RAP+ in CML group compared to control sample (17.5% versus 3.4%, p<0.001).

Figure 1 CD176 and IL1RAP antigens are co-expressed on CD34+ Leukemia stem cells. Peripheral blood mononuclear cells from patients with CML and healthy volunteers were isolated and stained for flow-cytometry analysis. (A) FACS Dot Blot showing expression of CD34 (top row) and co-expression of CD176 and IL1RAP antigens on the CD34+ cells (bottom row) in PBMCs from patients with CML compared to NPBMCs. (B) Bar graphs showing the BCR-ABL status relative to the percentage of IL1RAP and CD176 co-expression in the CD34+ subsets from patients with CML as compared to the normal control and the positive control (K562 cells). The BCR-ABL status is indicated below the sample. The error bars represent the variation in two independent experiments. (C) Average percentage of CD34+ and CD34+ CD176+ IL1RAP+ subsets in normal versus CML patients respectively. (D) Bar graphs showing the average count of colony-forming units (CFU) per 1000 CD34+CD176+IL1RAP- cells (open bar) or CD34+CD176+IL1RAP+ cells (solid bar) obtained from CML-2 and CML-4 samples. **p< 0.01, n.s represents that there is no significant difference between groups.

In order to analyze the progenitor activity of the various subpopulations, CML-2 and CML-4 were flow-sorted for CD34+CD176+IL1RAP+ and CD34+CD176+IL1RAP- then plated in media t support hematopoietic colony formation. The number of colonies, or colony-forming units (CFU), in CD34+CD176+IL1RAP+ pool represented 6% of the sorted cells with a significant difference between both populations, p<0.01 (Figure 1D and Figure S1).

To facilitate correct interaction of the VH and VL domains, site-directed mutagenesis was used to generate knob-in-hole mutations in the heavy and light chains of the constant domains (Figure 2A) via polymerase chain reaction overlap extension (Figures S2 and 3). Two PCR reactions were performed to generate two amplicons with the specific mutations included in the overlapping primers. The two fragments were then combined in a subsequent fusion reaction, in which the overlapping ends anneal, allowing the 3 overlap of each strand to serve as a primer for the 3 extension of the complementary strand. The resulting fusion product served as a template for amplification of the entire constant domain. In order to circumvent the light chain mismatching, an Orthogonal Fab interface was generated. In one Fab, complementary mutation was introduced and verified at the heavy chain constant domain (CH1_H172A_ F174G) and at the light chain constant domain (CL_L135Y_S176W), respectively (Figures S46). For the heavy chain heterodimerization, we used the Knob-in-Hole strategy, where we inserted the CH3 mutations (S354C and T366W) into different heavy chains (Figures S7 and 8). The VH and VL sequences were synthesized and cloned into the new pLM2-CH and -CL plasmids (Figure 2A) where CD176 was represented by TF1 (VH1 and VL1) and TF2 (VH2 and VL2) while IL1RAP was represented by Clone 4B6 (VHa and VLa) and Clone 4G9 (VHb and VLb). Then, we generated the four different bi-specific antibody mixtures (TF1RAPa, TF1RAPb, TF2RAPa, and TF2RAPb) to evaluate the most effective Bis-Ab (Figure 2B). The bispecific antibody was quantified by ELISA at 283 ng/mL. Since ELISA used the human IgG heavy chain antibody as the primary antibody and a goat anti-human lambda antibody conjugated to HRP as the secondary antibody, these data also confirm the correct association of the heavy and light chains and ensure that monomers are excluded.

Figure 2 The bi-specific antibody arms. (A) Schematic diagram of the bi-specific antibody showing the mutant arms and the antigen-binding domains. Thomsen-Freidenrich or CD176 domains (TF); IL1RAP domains (RAP); variable domain-heavy chain (VH); variable domain-light chain (VL); L135Y and S176W mutations (Y-W) in constant domain-light chain; H172A and F174G mutations in CH1 domain (A-G); S354C (C) or T366W (W) mutations in CH3. (B) Antibody mixtures generated by transient transfection of HEK 293T cells. TF1 and TF2 was paired with RAPa and RAPb to generate four Bis-Ab mixtures. The bispecific antibody concentration was 283 ng/mL as measured with ELISA. The correct association of the human IgG heavy chain and the lambda light chain was confirm and monomers were excluded by using anti-IgG primary antibodies and anti-light chain secondary antibodies.

KG1 cell line is an acute myeloid leukemia cell line that is known to be a positive control for CD176. For optimizing the staining protocol of CD176, KG1 cells were pre-treated with VCN to expose CD176 antigens for better staining (Figure S9). In order to test the binding capability and functional potential of our bi-specific antibody, we generated a dual-positive cell line for expressing both IL1RAP and CD176 through lentiviral transduction (Figure S10A and B). IL1RAP expression was increased by 1.5 folds in KG1/RAP cells as verified by flow cytometry (Figure S10C and D).

CD176 antigen is a glycosylated antigen; a protein antigen bound to GAL-NAC moiety which makes the antigen displayed on the cell surface yet not easy to isolate.21 For this reason, a flow-cytometry assay was used to evaluate both the binding capability and toxicity of our Bis-Ab using the gating strategy in Figure S11. KG1 and KG1/RAP cell lines were treated with the various Bis-Ab mixtures. Binding percentage was calculated from the percentage of IgG positive cells, where the secondary IgG antibody is bound to the primary Bis-Ab. The TF1RAPa Bis-Ab showed the highest binding in KG1/RAP cells (Figure 3A) as compared to other mixtures (p<0.001). In contrast, the TF1RAPb antibody revealed slightly reduced binding in KG1/RAP cells. On treating KG1/RAP cells with increasing amounts of TF1RAPa, more binding to the dual-positive KG1/RAP cells was observed (Figure 3B). To demonstrate the specificity of the Bis-Ab, we measured the competition with the CD176 and the IL1RAP monoclonal antibodies. Increasing concentrations of the Bis-Ab specifically inhibited the binding of both the IL1RAP and CD176 mAbs (Figure S12). Then, our KG1/RAP cells were treated with the Bis-Ab TF1RAPa and complement prior to staining with the LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, in order to evaluate whether CDC could be achieved using IL1RAP and CD176 as targets. Flow cytometric analysis revealed a significant increase in dead cells in the Bis-Ab treated CD176/IL1RAP dual-positive KG1/RAP population as antibody binding also increased (Figure 3C), p<0.001.

Figure 3 Validation of TF-RAP Bi-specific antibody in KG1 cell line and CML samples. (A) MFI for binding of different Bis-Ab mixtures in KG1/RAP (p <0.001). (B) Binding (%) of the Bis-Ab in KG1/RAP cell lines. (C) Shows live/dead (LD) staining (%) in KG1/RAP cell lines after treatment with the Bis-Ab and complement. (D) MFI for binding of different Bis-Ab mixtures p <0.001 in CML cells. (E) Binding of the Bis-Ab (%) in PBMCs from patients with CML. The binding affinity (Kd) of our bispecific antibody was 21ng/mL, calculated using the % RO = [Ab]/([Ab]+Kd) 100%, where RO is the receptor occupancy, Ab is the concentration of antibody, and Kd is the equilibrium dissociation constant. This Bis-Ab platform used in this study had the correct molecular weight (95 KDa) and assembled properly (93%) as revealed by SDS-PAGE analysis.38 (F) Live/dead (L/D) staining (%) from patients with CML after treatment with the Bis-Ab and complement. The red square were L/D positive cells treated with CyO2; the percent of L/D staining in normal PBMCs is shown in blue. Each point represents the mean increase in L/D staining SEM with three to four replicates. Data from normal samples were low for all doses (data not shown).

Binding of TF1RAPa, TF2RAPa, and TF2RAPb was also tested in PBMCs from patients with CML. Again, TF1RAPa showed the highest binding relative to other mixtures (p<0.001) (Figure 3D) and with increasing doses (Figure 3E). Based on the CML binding curve, the binding affinity (Kd) of our bispecific antibody was 21 ng/mL. Other therapeutic antibodies, such as ofatumumab directed against CD20, have shown significant CDC against peripheral blood cells obtained from CML patients in chronic phases26 and B cells in CLL,29 respectively. Thus, the TF1RAPa cocktail was used to generate the doseresponse curve and to evaluate whether CDC could be achieved using both IL1RAP and CD176 as targets. The ability of the TF1RAPa cocktail was compared to human anti-IL1RAP and anti-CD176 monoclonal antibodies to induce cell death in PBMCs from patients with CML. PBMCs from CML1-4 were tested in CDC assays in parallel to cells from healthy control samples. In CML cells, the binding of TF1RAPa mediated CDC at higher levels than in normal peripheral blood mononuclear control cells, correlating with the expression level of IL1RAP and CD176, particularly at lower antibody concentrations (Figure 3F). More strikingly, among peripheral blood cells, TF1RAPa did not induce CDC of normal cells, whereas a clear dose-dependent CDC effect was observed in CML cells (Figure S13A and B). To address the selectivity of IL1RAP/CD176-targeting antibodies, we also validated the bispecific antibody cytotoxicity on the various subpopulations in peripheral blood. The dual-positive CD176+IL1RAP+ cell populations showed the highest CDC activity as compared to CD176+IL1RAP-, CD176-IL1RAP+, and CD176-IL1RAP- populations (Figure 4 and S13CF, S14).

Figure 4 Dose-response curve of TF1RAPa Bis-Ab on CDC in CML samples. A dose-response curve showing the selective killing potential of CD176+IL1RAP+ subpopulation by the TF1RAPa Bis-Ab as compared to other subpopulations in PBMCs from patients with CML. Each point represents the mean SEM of the four samples.

Targeting molecules involved in multiple pathways is proving to be one of the most reliable strategies for eradicating cancer stem cells. In this report, we present a novel bi-specific antibody, TF/RAP, capable of targeting ThomsenFriedenreich (TF, CD176) and IL1RAP antigens on CD34+ HSCs in CML and on cell lines. TF is a glycoprotein that has many domains and motifs (eg, LGALS3, Gal(1,3)GalNAc, LGalS3BP), many related to signaling pathways. It is a known marker for ongoing tumorigenesis and metastasis, as it is expressed on various cancer-initiating cells.8 Interestingly, CD34 and LGALS3 were found to be co-expressed in myeloid cells.30,31 LGALS3 and ABL1 are involved in regulating RUNX1 and the transcription of genes involved in differentiation of hematopoietic stem cells,32 especially myeloid cells33 (Figure S15) IL1RAP, on the other hand, is a member of the Toll-like receptor superfamily and is a well-known co-receptor of IL1R1.34 IL1RAP plays a role in mediating the effect of the pro-inflammatory cytokine IL-1 and is also involved in activating T cells and mast cells after mediating the signal of IL-1 cytokine.35 It has previously been characterized as a tightly related marker for BCR-ABL positive cells.7 Together, both TF and IL1RAP were related to apoptotic pathways; IL1RAP up-regulation was associated with decreased apoptosis in AML,36 and anti-CD176 antibody induced apoptosis of CD176-positive leukemic cells through multiple pathways.12 Although we did not find a direct link between IL1RAP, CD176 and leukemogenesis, previous studies have shown that each of them is separately expressed on CD34+ cells in leukemia cell lines8,10,12 and patients with CML7

Therefore, we conducted this pilot study, in order to assess the co-expression of IL1RAP and ThomsenFriedenreich (CD176) antigens on CD34+ HSCs in peripheral blood of patients with CML, using FACS gene expression analyses. Flow-drop FISH and CFU assays were used for the separation of CD34+CD176 BCR-ABL+ and BCR-ABL CML stem cells, based on IL1RAP expression.7 CFU numbers were significantly lower in CD34+CD176+IL1RAP- cells than in CD34+CD176+IL1RAP+ cells, obtained from CML-2 and CML-4 samples (Figure 1D), particularly CML-2 sample which was obtained from a patient in remission (BCR-ABL-). We found that the frequency of clonogenic hematopoietic progenitor cells was increased in the CD34+ CD176+IL1RAP+ cells in these samples. Testing the stem-cell characteristics of these two cell populations in immune-deficient mice would have been advantageous. Yet, the low numbers of sorted CML cells acquired from the CD34+CD176+ IL1RAP and IL1RAP+ cell subpopulations, alongwith the general low engrafting efficiency of chronic phase CML cells in these mice7 prevented us from successfully performing such experiments. Importantly, as IL1RAP expression was correlated with changes from chronic phase (CP) into accelerated phase (AP) and blast phase (BP)37, we also found that the level of IL1RAP/CD176 co-expressionwas increased, in our patient samples, as the disease progressed, independent of the treatment status(Table S3).

To target both TF and IL1RAP simultaneously, we developed a Bis-Ab specific for both antigens. Because antibodies are normally heterodimers of two heavy and two light chains, we modified the constant domains in the Bis-Ab to maximize the correct interactions of the four immunoglobulin chains within single cells. Here, we used the orthogonal Fab design; CH1_H172A_F174G and CL_L135Y_S176W38 to facilitate selective assembly of the Fab arms for correct dimerization of the antigen-binding domains.39 Therefore, we mutated CH1 and CL binding sites to restrict the assembly of the Fab with the correct VD pairs. The RAP VDs were cloned with the wild type Fab; and the TF VD was linked to the mutant orthogonal Fab design. Published data have shown that the component proteins of this Bis-Ab platform proper assembly were detected at 93% and the complex had a molecular weight of 95 KDa, as revealed by SDS-PAGE analysis.38 Additionally, the CH3 for each Fab was mutated with previously described knob-into-hole mutations40,41 to facilitate hetero-dimerization between the TF and the RAP heavy chains. In our study, we used ELISA to demonstrate that both the VD and Fc were properly paired. Here, because the primary antibody was anti-human VL and the secondary antibody was anti-human IgG, quantifying the Bis-Ab also demonstrated the VD-Fc interactions.

To efficiently validate the specific binding of our Bis-Ab, we generated a dual-positive cell line; KG1/RAP. KG1 cell line expresses CD176+, but IL1RAP is low or absent. Therefore, we induced IL1RAP expression in KG1 cells by lentiviral mediated-gene transfer, as previously usedin both immune42 and leukemic cells.43 In the competitive binding assay, increasing concentrations of the Bis-Ab blocked the binding of CD176 and IL1-RAP monoclonal antibodies to the KG1/RAP and KG1 parental cells, demonstrating the specific binding of the Bis-Ab. The level of CD176 expression in KG1 cell line was detected before and after VCN treatment. Increased staining of the KG1/RAP cells compared to the parental KG1 cells indicated that expression of the IL1RAP facilitates the interaction of the Bis-Ab with the target cell. This increased binding of the Bis-Ab to the KG1/RAP cells also increased their susceptibility to complement-dependent cytotoxicity (CDC). We also observed increased binding and increased CDC in the CD176+ IL1RAP+ population of the peripheralblood from patients with CML. As a pilot study and given that on average, 50% of the cells within the CD34+ subpopulation in the patients tested were dual positive for CD176 and IL1RAP antigens, in addition to the almost undetectable CDC in CD34+ cells in normal controls, our data strongly support the idea that the bi-specific antibody (TF/RAP) indeed induces CDC preferentially in CD176+ IL1RAP+ CML CD34+ cells. In generating a bi-specific antibody that targets CD176 and IL1RAP, we are unique in providing proof of concept that CML CD34+CD176+ IL1RAP+ cells can be targeted while preserving corresponding normal cells. The potential to target multiple antigens is supported by studies that demonstrated increased or synergistic CDC activity by non-cross blocking CD20 antibody combinations.44

Therapeutic antibodies are commonly administered intravenously, yet selectivity and specificity are a major concern for reduced toxicity. CD176/IL1RAP co-expression was not present in monocytes unlike the reported weak but present IL1RAP expression in monocytes.7 Both antigens were low or absent in most types of normal bone-marrow progenitor and mature cell types, suggesting that CD176/IL1RAP dual targeting antibodies are expected to show low toxicity on normal hematopoietic cells. Being strongly expressed on the surface of cancer cells and virtually absent from normal tissues, CD176 was evaluated as a potential target for cancer biotherapy with the development of anti-CD176 antibody that induced apoptosis of leukemic cells.8 Added to this, antibodies against IL1RAP were found to be capable of blocking IL-1 signaling as well as inhibiting tumor cells' growth in AML,34 CML,7 breast cancer,45 prostate cancer, breast cancer, lung cancer, colorectal cancer, melanomas, bladder cancer, brain/CNS cancer, cervical cancer, esophageal cancer, gastric cancer, head/neck cancer, kidney cancer, liver cancer, lymphomas, ovarian cancer, pancreatic cancer, and sarcomas46 especially in cancer stem cells, or (CSCs) and progenitor cells, which are responsible, directly or indirectly, for the development of a solid tumor.47 Thus, it may be thatour Bis-Ab will not only eradicate the CD176+IL1RAP+ drug-resistantCML stem cells but also may have universal therapeutic potential for preventing relapses in both solid and hematological cancers.Given that the mode of action in CDC is having the antibody direct the complement pathway to target cell killing, we suggest that this therapeutic strategy would be independent of known mechanisms of TKI resistance in CML. Thus, the concept of complement-mediated killing of IL1RAP/CD176 expressing cells may also have the potential to eradicate such cells in patients, either alone or in combination with current regimens, in order to increase their therapeutic effectiveness. And finally, expanded studies need to be performed in order to confirm the co-expression of both markers, especially in resistant and relapsed cancer patients as well as in patient-derived xenografts (PDX).

The experimental research was mostly supported by a fellowship to REE from the Egyptian Ministry of Higher Education, Cultural, and Missions Section (JS 3577). The lentiviral vectorHRST-cmvGFPand the packaging plasmids were akind gift from Richard C.Mulligan in the Harvard Gene Therapy Institute. The human IgG heavy and light chain constant genes were provided by JE Robinson (Tulane University). C Wu and SEB were supported by AI110158 and/or OD01104-51; EUA and SEB were supported by the Applied Stem Cell Laboratory.

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work. All authors have given approval of the final version of the article; and have agreed to be accountable for all aspects of the work.

The abstract of this paper was presented at the AACR annual Meeting 2019; March 29 April3, 2019; Atlanta, GA, as a poster presentation with interim findings. The posters abstract was published in Poster Abstracts in the AACR meeting proceedings and as a supplement in the AACR Cancer Research Journal [https://cancerres.aacrjournals.org/content/79/13_Supplement/1222A].

Raghda Eldesouki reports grants from Egyptian Ministry of Higher Education. Stephen EBraun reports grants from Egyptian Ministry of Education, Alliance for Cardiovascular Research, NIAID OD01104, and Braun/McGroarty Charitable Fund, during the conduct of the study. In addition, Dr Raghda Eldesouki, Dr Stephen Braun, Dr Fouad Badr and Dr Eman Abdel-Moemen Mohammedhave apatent, PCT/EG2019/000014, pending. The authors report no other conflicts of interest in this work.

1. Marchetti M. Cost-effectiveness of kinase inhibitors for hematologic malignancies: a systematic and critical review. Expert Rev Pharmacoecon Outcomes Res. 2017;17(5):469480. doi:10.1080/14737167.2017.1366858

2. Holyoake TL, Helgason GV. Do we need more drugs for chronic myeloid leukemia? Immunol Rev. 2015;263(1):106123.

3. Zhou H, Xu R. Leukemia stem cells: the root of chronic myeloid leukemia. Protein Cell. 2015;6(6):403412.

4. Holyoake TL, Vetrie D. The chronic myeloid leukemia stem cell: stemming the tide of persistence. Blood. 2017;129(12):15951606. doi:10.1182/blood-2016-09-696013

5. Koptyra M, Falinski R, Nowicki MO, et al. BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance. Blood. 2006;108(1):319327. doi:10.1182/blood-2005-07-2815

6. Tasian SK, Bornhuser M, Rutella S. Targeting leukemia stem cells in the bone marrow niche. Biomedicines. 2018;6(1):22. doi:10.3390/biomedicines6010022

7. Jrs M, Johnels P, Hansen N, et al. Isolation and killing of candidate chronic myeloid leukemia stem cells by antibody targeting of IL-1 receptor accessory protein. Proc Natl Acad Sci U S A. 2010;107(37):1628016285. doi:10.1073/pnas.1004408107

8. Goletz S, Cao Y, Danielczyk A, Ravn P, Schoeber U, Karsten U. Thomsen-Friedenreich antigen: the hidden tumor antigen. Adv Exp Med Biol. 2003;535:147162.

9. Kurtenkov O, Innos K, Sergejev B, Klaamas K. The Thomsen-Friedenreich antigen-specific antibody signatures in patients with breast cancer. Bio Med Res Int. 2018;2018:9579828.

10. Sindrewicz P, Lian LY, Yu LG. Interaction of the onco-fetal Thomsen-Friedenreich antigen with galectins in cancer progression and metastasis. Front Oncol. 2016;6:79. doi:10.3389/fonc.2016.00079

11. Lin WM, Karsten U, Goletz S, Cheng RC, Cao Y. Expression of CD176 (Thomsen-Friedenreich antigen) on lung, breast, and liver cancer-initiating cells. Int J Exp Pathol. 2011;92(2):97105. doi:10.1111/j.1365-2613.2010.00747.x

12. Yi B, Zhang M, Schwartz-Albiez R, Cao Y. Mechanisms of the apoptosis induced by CD176 antibody in human leukemic cells. Int J Oncol. 2011;38:15651573.

13. Fan G, Wang Z, Hao M, Li J. Bi-specific antibodies and their applications. J Hematol Oncol. 2015;8:130. doi:10.1186/s13045-015-0227-0

14. Varela MA. Identification of sequences common to more than one therapeutic target to treat complex diseases: simulating the high variance in sequence interactivity evolved to modulate robust phenotypes. BMC Genom. 2015;16(1):530. doi:10.1186/s12864-015-1727-6

15. Wu C, Lu Y. High-titre retroviral vector system for efficient gene delivery into human and mouse cells of hematopoietic and lymphocytic lineages. J Gen Virol. 2010;91(8):19091918. doi:10.1099/vir.0.020255-0

16. Ge D, Zhang QS, Zabaleta J, et al. Doublecortin may play a role in defining chondrocyte phenotype. Int J Mol Sci. 2014;15(4):69416960. doi:10.3390/ijms15046941

17. Braun SE, Wong FE, Connole M, et al. Inhibition of simian/human immunodeficiency virus replication in CD4+ T cells derived from lentiviral-transduced CD34+ hematopoietic cells. Mol Ther. 2005;12(6):11571167. doi:10.1016/j.ymthe.2005.07.698

18. Braun SE, Lu XV, Wong FE, et al. Potent inhibition of simian immunodeficiency virus (SIV) replication by an SIV-based lentiviral vector expressing antisense Env. Hum Gene Ther. 2007;18(7):653664. doi:10.1089/hum.2007.003

19. Robinson JE, Hastie KM, Cross RW, et al. Most neutralizing human monoclonal antibodies target novel epitopes requiring both Lassa virus glycoprotein subunits. Nat Commun. 2016;7:11544. doi:10.1038/ncomms11544

20. Goltez S, Karasten U Cancer stem cell markers and uses thereof. WIPO, WO2011089004A1 2011 Jul 28.

21. Jiang Y, Tso J, Karsunky H. Antibodies that bind membrane-bound IL1rap. European patent EP2935334A1. 2015 Oct 28.

22. Keaglen MB, Gersen SL. Basic cytogenetics laboratory procedures. In: Gersen SL, Keagle MB, editors. The Principles of Clinical Cytogenetics. NewYork, NY: Springer NewYork; 2013:5365.

23. International Standing Committee on Human Cytogenetic Nomenclature. ISCN2016: An International System for Human Cytogenetic Nomenclature. Karger Medical and Scientific Publishers; 2016.

24. Broxmeyer HE, Etienne-Julan M, Gotoh A, et al. Hematopoietic colony formation from human growth factor-dependent TF1 cells and human cord blood myeloid progenitor cells depends on SHP2 phosphatase function. Stem Cells Dev. 2013;22(6):9981006. doi:10.1089/scd.2012.0478

25. Balduini A, Broxmeyer HE, Braun SE, Cornetta K, Lyman S. Comparative effects of retroviral mediated gene transfer into primary human stromal cells of flt3ligand, interleukin 3 and gmcsf on production of cord blood progenitor cells in longterm culture. Stem Cells. 1998;16:3749. doi:10.1002/stem.5530160807

26. Tatake RJ, Maniar HS, Chiplunkar SV, et al. Antibody-dependent cellular cytotoxicity and complement-mediated cytotoxicity on leukemic cells mediated by anti K562 monoclonal antibodies. J Clin Lab Immunol. 1990;31(2):8791.

27. Lindorfer MA, Beum PV, Taylor RP. CD20 mAb-mediated complement dependent cytotoxicity of tumor cells is enhanced by blocking the action of factor I. Antibodies. 2013;2:598616. doi:10.3390/antib2040598

28. Gerlach SL, Chander PK, Roy U, et al. The membrane-active phytopeptide. Cycloviolacin O2 simultaneously targets HIV1-infected cells and infectious viral particles to potentiate the efficacy of antiretroviral drugs. Medicines (Basel). 2019;6(1):E33. doi:10.3390/medicines6010033

29. Zen CS, Secreto CR, LaPlant BR, et al. Direct and complement dependent cytotoxicity in CLL cells from patients with high-risk early-intermediate stage chronic lymphocytic leukemia (CLL) treated with alemtuzumab and rituximab. Leuk Res. 2008;32(12):18491856. doi:10.1016/j.leukres.2008.05.014

30. Marer N. Galectin3 expression in differentiating human myeloid cells. Cell Biol Int. 2000;24:245251. doi:10.1006/cbir.1999.0501

31. Labbaye C, Testa U. The emerging role of MIR-146A in the control of hematopoiesis, immune function and cancer. J Hematol Oncol. 2012;5:13. doi:10.1186/1756-8722-5-13

32. Huang H, Woo AJ, Waldon Z, et al. A Src family kinase-Shp2 axis controls RUNX1 activity in megakaryocyte and T-lymphocyte differentiation. Genes Dev. 2012;26(14):15871601. doi:10.1101/gad.192054.112

33. Zhang HY, Jin L, Stilling GA, et al. RUNX1 and RUNX2 upregulate Galectin-3 expression in human pituitary tumors. Endocrine. 2009;35(1):101111. doi:10.1007/s12020-008-9129-z

34. gerstam H, Karlsson C, Hansen N, et al. Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia. Proc Natl Acad Sci U S A. 2015;112(34):1078610791.

35. McEntee CP, Finlay CM, Lavelle EC. Divergent roles for the IL-1 family in gastrointestinal homeostasis and inflammation. Front Immunol. 2019;10:1266.

36. Barreyro L, Will B, Bartholdy B, et al. Over expression of IL-1 receptor accessory protein in stem and progenitor cells and outcome correlation in AML and MDS. Blood. 2012;120(6):12901298. doi:10.1182/blood-2012-01-404699

37. Zhao K, Yin LL, Zhao DM, et al. IL1RAP as a surface marker for leukemia stem cells is related to a clinical phase of chronic myeloid leukemia patients. Int J Clin Exp Med. 2014;7(12):47874798.

38. Lewis SM, Wu X, Pustilnik A, et al. Generation of bi-specific IgG antibodies by structure-based design of an orthogonal Fab interface. Nat Biotechnol. 2014;32:191198. doi:10.1038/nbt.2797

39. Spidel JL, Vaessen B, Chan YY, Grasso LJ, Kline B. Rapid high-throughput cloning and stable expression of antibodies in HEK293 cells. J Immunol Methods. 2016;439:5058. doi:10.1016/j.jim.2016.09.007

40. Ridgway JB, Presta LG, Carter P. Knobs-into-holes engineering of antibody CH3 domains for heavy chain heterodimerization. Protein Eng. 1996;9:617621. doi:10.1093/protein/9.7.617

41. Atwell S, Ridgway JB, Wells JA, Carter P. Stable heterodimers from remodeling the domain interface of a homodimer using a phage display library. J Mol Biol. 1997;270:2635. doi:10.1006/jmbi.1997.1116

42. Pan H, Mostoslavsky G, Eruslanov E, Kotton DN, Kramnik I. Dual-promoter lentiviral system allows inducible expression of noxious proteins in macrophages. J Immunol Methods. 2007;329(12):3144. doi:10.1016/j.jim.2007.09.009

43. Biagi E, Bambacioni F, Gaipa G, et al. Efficient lentiviral transduction of primary human acute myelogenous and lymphoblastic leukemia cells. Haematologica. 2001;86(1):1316.

44. Melis JP, Strumane K, Ruuls SR, Beurskens FJ, Schuurman J, Parren PW. Complement in therapy and disease: regulating the complement system with antibody-based therapeutics. Mol Immunol. 2015;67:117130. doi:10.1016/j.molimm.2015.01.028

45. Liberg D, nnervik P, Riva M, Larsson L, Forsberg G, Wachenfeldt K. Antibody Blockade of IL1RAP Signaling Reduces Metastasis in a Breast Cancer Model. Annual Meeting of the American Association for Cancer: McCormick Place North/South Chicago, Illinois, USA; 2018.

46. Fioretos T, Jaras M Method of treatment of a solid tumor with interleukin-1 accessory protein antibody. United States patent US 9403906B2. 2016 Aug 02.

47. Fioretos T, Jaras M. Anti - IL1rap antibodies and their use for treating human. European patent EP2665749A1. 2013 Nov 27.

Originally posted here:
[Full text] Identification and Targeting of ThomsenFriedenreich and IL1RAP | OTT - Dove Medical Press

To Read More: [Full text] Identification and Targeting of ThomsenFriedenreich and IL1RAP | OTT – Dove Medical Press
categoriaBone Marrow Stem Cells commentoComments Off on [Full text] Identification and Targeting of ThomsenFriedenreich and IL1RAP | OTT – Dove Medical Press | dataJanuary 22nd, 2021
Read All

[Full text] Clinical Analysis of Bloodstream Infections During Agranulocytosis Aft | IDR – Dove Medical Press

By daniellenierenberg

Introduction

Allogeneic hematopoietic stem cell transplantation (allo-HSCT) is a treatment process for restoring normal hematopoietic and immune functions. In this method, patients undergo high-dose radiotherapy and chemotherapy, and immunosuppressive pre-treatment is done to eliminate abnormal hematopoietic and immune systems. The patient is then transfused with allogeneic hematopoietic stem cells. This strategy is an effective cure for blood diseases, bone marrow failure syndrome, and immune deficiency.1,2 However, neutrophil deficiency, impaired mucosal barrier, and weakened immune function typically occur after transplantation, which increases the risk of infection after HSCT.3

Bloodstream infections (BSI) are a severe type of systemic infectious disease caused by the invasion of the circulatory system by pathogenic microorganisms. Notably, BSI is a common complication in the early stages of allo-HSCT and has an incidence rate of 13.6%38.9%.47 According to literature, the occurrence of bloodstream infections is a huge risk factor to early deaths after HSCT.810 The occurrence of BSI after HSCT is exacerbated by the widespread use of antibiotics and the resultant antibacterial resistance, especially multi-drug-resistant bacteria (MDR) that seriously affects the survival of transplant patients.1113 Thus, evaluation of the distribution and prevalence of drug-resistant pathogens of the bloodstream in allo-HSCT patients and the study of the BSI risk factors could guide the course of clinical treatment for BSI prevention and control. This study retrospectively analyzed the BSI risk factors in patients with allo-HSCT in the First Affiliated Hospital of Zhengzhou University from 2013 to 2017. The detection rate, distribution, and drug sensitivity of pathogenic bacteria after allo-HSCT was also evaluated.

From January 2013 to December 2017, 397 patients who received allogeneic HSCT for the treatment of hematological diseases in the First Affiliated Hospital of Zhengzhou University were selected. The patients included 242 males and 155 females, with a median age of 21 (162) years. Of these, 115 cases had acute myeloid leukemia (AML), 110 with severe aplastic anemia (SAA), 102 with acute lymphocytic leukemia (ALL), and 70 patients with other conditions.

According to the difference in the histocompatible typing and relationship, allo-HSCT is divided into matched sibling transplantation, partially matched related transplantation and matched unrelated transplantation. Among the 397 cases of allo-HSCT, 177 were matched sibling transplantation, 165 were partially matched related transplantation, and 55 were matched unrelated transplantation. According to the stem cell source, there were 333 cases of peripheral hematopoietic origin, 55 from peripheral blood combined with bone marrow transplantation, and nine involved cord blood transplantation.

Central vein catheterization was performed for all patients before transplantation conditioning. Modified busulfan/cyclophosphamide (Bu/Cy) and total body irradiation/cyclophosphamide (TBI/Cy) conditioning regimens were used for patients with acute leukemia, myelodysplastic syndrome, and lymphoma. Meanwhile, cyclophosphamide + anti-thymocyte globulin (Cy-ATG) and FluCy-ATG pre-treatment regimens were used for severe aplastic anemia. The GVHD prevention program used cyclosporine combined with mycophenolate mofetil and methotrexate, of which 272 cases were also treated with ATG to prevent GVHD.

All HSCT patients were admitted to the laminar flow purification ward after a medicated bath, and were given a sterile diet, and received oral, eye, nose, and perianal care. Take a 1:2000 chlorhexidine liquid medicinal bath for 20 minutes; routinely gargle with saline and cermetium chloride before and after three meals a day, add metronidazole solution if necessary; use 1% chloramphenicol, 0.5% Rifampicin eye drops alternate eye drops, 4 times/d; alternate nose drops with houttuynia cordata and streptomycin nasal drops, 4 times/d; rinse the perineum with warm water after each bowel movement, 3% boric acid solution for a bath for 20 Minutes, mupirocin is applied to the perianal area. Itraconazole, berberine, and compound sulfamethoxazole were administered orally for intestinal disinfection two weeks before transplantation. If the body temperature of patients got to 38.00C during transplantation or shivering occurred, 10 mL of blood from the peripheral vein was collected using standard. The blood was drawn twice in a row for separate cultivation of aerobic and anaerobic bacteria. For positive cases, broad-spectrum antibiotics were administered intravenously, and the treatment efficacy was evaluated 48 hours after the initial treatment. Treatment efficacy was empirically assessed based on blood culture results, WBC, C-reactive protein, and procalcitonin levels, after which ineffective treatment strategies were adjusted.

Agranulocytosis refers to the absolute value of neutrophils <0.5 109/L,14 while granulocyte reconstitution refers to neutrophils 0.5 109/L for three consecutive days after transplantation.

Fever is a single measurement of oral temperature 38.3C (axillary temperature 38.0C) or 38.0C (axillary temperature 37.7C) for more than 1 hour.

The pathogenic diagnosis of BSI was made after the isolation of pathogenic microorganisms from blood culture. If the same patient isolates the same bacteria, if the drug sensitivity is the same, it is 1 BSI. BSI-related mortality was defined as death occurring within 30 days after the diagnosis of BSI. Pre-engraftment BSI is defined as the infection that arises from the onset of the pre-treatment regimen to the time before granulocyte implantation.

VersaTREK automatic blood culture instrument (Thermo Fisher, USA), VITEK MS IVD 3.0 mass spectrometer identification instrument and VITEK2 Compact automatic microbial identification, and drug sensitivity analysis system for bacterial culture, identification, and drug sensitivity detection, spread through paper (K-B) method and E-Test were used in in vitro susceptibility tests and review of abnormal susceptibility results. The results were interpreted according to the standards issued by the United States Committee for Clinical and Laboratory Standardization (CLSI).15

The SPSS21.0 software was used for statistical analysis, and descriptive statistics were used to summarize clinical features. The univariate analysis used a chi-square test, while logistic regression was applied for multivariate analysis. A P-value of 0.05 was used as the level of significance; thus, P<0.05 indicated statistically significant differences.

Among the 397 HSCT patients, 294 had agranulocytosis fever, out of which 52 were microbiologically confirmed as BSIs. Therefore, the incidence of BSI was 17.7% (52/294), accounting for 13.1% (52/397) of all transplant patients. The implantation time of neutrophils is 13 days (11,15), and the time from agranulocytosis to BSI is 12 days (7,30). For 294 patients, we did 607 blood cultures, among which 60 were positive (9.9% positive blood culture rate). Out of the 294 patients, six had two or more pathogenic bacteria.

Sixty pathogens were detected in 52 patients, including 43 Gram-negative bacteria (71.67%), 10 Gram-positive bacteria (16.67%), and 7 fungi (11.67%). We found that Gram-negative bacteria accounted for most BSIs, followed by Gram-positive bacteria, and fungal infections were the least. The numbers and proportions of different strains of pathogenic bacteria are shown in Figure 1. In terms of drug resistance, the extended-spectrum -lactamase (ESBL) detection rates of E. coli and K. pneumoniae were 46.7% (7/15) and 30% (3/10), respectively. Carbapenem-resistant Enterobacteriaceae (CRE) accounted for 17.9% (5/28). The recorded patterns for Gram-negative bacteria drug susceptibility are shown in Table 1. The two staphylococci detected in Gram-positive bacteria were all methicillin-resistant, and all the three enterococci were sensitive to vancomycin, teicoplanin, and linezolid. The detected fungi belong to the genus Candida, and the resistance rates to itraconazole and voriconazole were 57.1% and 28.6%, respectively.

Table 1 Resistance Rate of Major Gram-Negative Bacteria to Common Antibacterial Drugs

Figure 1 Distribution of 60 isolated pathogenic bacteria pathogen.

Out of the 52 BSI patients, 33 improved after treatment, while 19 died after treatment failed (36.5%). Among the 19, 13 had Gram-negative bacteria infection, three were Candida infections, while another three were mixed Gram-negative and Gram-positive bacterial infection. Six of the seven patients who were resistant to carbapenems died.

We divided the 294 patients with agranular fever into two groups: BSI-free (242) and BSI (52). Univariate and multivariate analyses were applied for the study of BSI risk factors, including patients age, gender, disease type, stem cell source, pre-treatment application of ATG, combined diarrhea, oral ulcers, and presence of granules. Univariate analysis results demonstrated that the occurrence of BSI was correlated to the transplantation method, pre-treatment application of ATG, agranulocytosis time (21 days), and stem cell source (Table 2). Meanwhile, multivariate analysis showed that pre-treatment application of ATG, agranulocytosis time (21 days), and stem cell source were risk factors for BSI (Table 3).

Table 2 Univariate Analysis of Risk Factors for BSI

Table 3 Multivariate Analysis of Risk Factors for BSI

Allo-HSCT patients undergo prolonged agranulocytosis and develop an impaired mucosal barrier. Besides, the long-term use of immunosuppressive agents increases the incidence of bloodstream infections.47 In the present study, the incidence of bloodstream infections was 13.1% in all patients, and 17.7% in patients with febrile neutropenia. A previous study conducted in China reported that the incidence of bloodstream infections in patients with febrile neutropenia was 17.0%.16 Thus, our findings are consistent with earlier results of other studies. The mortality rate of allo-HSCT bloodstream infections in our center was 36.5%, which is higher than the 26.9% reported by Mikulska et al17 and the 31.1% reported by Stoma et al.18 In addition, studies by Stoma et al also found that the application of fluoroquinolones can reduce the incidence of bloodstream infections by affecting the colonization of intestinal bacteria, while insufficient empirical antibacterial treatment is associated with increased mortality.18,19 This disparity suggests that we should pay attention to the prevention and treatment of bloodstream infections in transplant patients and formulate anti-infection strategies based on the distribution of pathogens and drug resistance patterns to improve transplantation and survival rates.

This study detected 60 pathogens in BSIs, of which gram-negative bacteria (71.67%) were the main ones, followed by gram-positive bacteria (16.67%), and fungi were the least (11.67%) (Figure 1). Gram-negative bacteria were mainly of the Enterobacteriaceae family, particularly E. coli and K. pneumoniae. The non-fermenting bacteria P. aeruginosa was also detected. A 25-year study in Spain showed that BSIs after HSCT were mainly caused by gram-positive bacteria, with a downward trend in positive bacteria and an increasing trend in gram-negative bacteria.20 Blennow et al also reported similar conclusions.21 However, many transplant centers in China have reported that BSIs after HSCT are mainly caused by gram-negative bacteria, followed by gram-positive bacteria, while fungi make up the least proportion. Thus, the epidemiology of BSIs in our center conforms to the distribution pattern reported in other centers in China.22,23

In this study, the common Enterobacteriaceae (E. coli and K. pneumoniae) had ESBL detection rates of 46.7% and 30%, respectively, and carbapenem resistance rates of the two bacteria were 6.7% and 30%, respectively (Table 1). Thus, we found that E. coli is highly sensitive to carbapenem drugs, suggesting that these drugs can be used for empiric antibacterial treatment. The ESBL positivity rate and carbapenem resistance rate of K. pneumoniae were both 30% (Table 1), indicating that its clinical treatment can be a combination of tigecycline, polymyxin, and other drugs. Notably, research shows that combination therapy with antibacterial medications such as cyclin and polymyxin can reduce the mortality of patients.24,25 In the present study, the resistance rate of P. aeruginosa to carbapenems was 28.6%, while its resistance rate to both aminoglycosides and quinolones was 14.3% (Table 1). Thus, a combination of carbapenems, aminoglycosides, and quinolones can be used for clinical treatment. Multi-center research in China reported carbapenem resistance rates of 3.6% and 18.9% for E. coli and K. pneumoniae, respectively.26 Similarly, this study revealed high resistance of E. coli and K. pneumoniae to carbapenem. The high rate of mycene resistance could be attributed to the repeated use of broad-spectrum antibiotics in transplant patients and the continuous increase in multi-drug-resistant bacteria in recent years.27 In response to the rise in multi-drug-resistant bacteria, our center uses perianal swabs to regularly screen intestine colonizing bacteria in transplant patients. As such, pathogenic bacteria are identified early, and treatment strategies are adjusted based on drug sensitivity results. The sensitivity of Gram-positive bacteria to the glycopeptides vancomycin, linezolid, and teicoplanin was 100.0%, suggesting that Gram-positive bacteria BSIs can be completely treated in clinical practice. Thus, glycopeptide or azole drugs can be the first choice for the treatment of Gram-positive bacteria BSIs.

All the seven fungi in this study were Candida, and Candida tropicalis was the predominant species. The resistance rates to itraconazole and voriconazole were 57.1% and 28.6%, respectively. The mortality rate of candidiasis was high, which significantly threatened the survival of transplant patients. According to previous studies, caspofungin should form the first choice fungal treatment after allo-HSCT in clinical practice, combined with antifungal treatment if necessary.28,29

The single-factor and multi-factor analysis results showed that pre-treatment application of ATG, agranulocytosis time (21 days), and stem cell source were risk factors for BSI. The removal of T-lymphocytes from the body of ATG-pretreated patients significantly delays immune reconstitution,30 and the continued lack of granulocytes causes immunodeficiency in transplant patients, thus increasing the risk to BSIs. Peripheral blood combined with bone marrow transplantation, hematopoietic implantation is relatively fast, which may be the reason for the lower incidence of BSIs in this group of patients, relative to peripheral blood and cord blood transplantation.3133

The results of this study show that BSI is a common complication of allo-HSCT patients with agranulocytosis. Gram-negative bacteria were the most prevalent pathogen in BSIs, and drug resistance to carbapenem drugs was relatively high. The use of ATG in pre-treatment, agranulocytosis time (21 days), and stem cell source are risk factors for BSI. The high mortality rate of BSI substantially affects the prognosis of transplant patients, and attention should be paid on the distribution of pathogenic bacteria and drug resistance in the bloodstream of transplant patients. Besides, the treatment plan should be adjusted based on the specific bacteria and drug resistance patterns.

The patient consent was waived, since the research involves no more than minimal risk to the subjects because the review of subjects medical records is for limited information. The information is not sensitive in nature, and the data are derived from clinically indicated procedures. The precautions taken to limit the record review to specified data and the coding of the data further minimize the primary risk, which is a breach of confidentiality. This study has been approved by the ethics review committee of the research project of the First Affiliated Hospital of Zhengzhou University, and has obtained relevant certificates.

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work. This study complies with the Declaration of Helsinki.

This project was supported by the Key Scientific Research Project Plan of Higher Education Institutions in Henan Province (18A320040).

The authors report no conflicts of interest in this work.

1. Barriga F, Ramirez P, Wietstruck A, Rojas N. Hematopoietic stem cell transplantation: clinical use and perspectives. Biol Res. 2012;45(3):307316. doi:10.4067/S0716-97602012000300012

2. Passweg JR, Baldomero H, Bader P, et al. Use of haploidentical stem cell transplantation continues to increase: the 2015 European Society for Blood and Marrow Transplant activity survey report. Bone Marrow Transplant. 2017;52(6):811817. doi:10.1038/bmt.2017.34

3. Gudiol C, Garcia-Vidal C, Arnan M, et al. Etiology, clinical features and outcomes of pre-engraftment and post-engraftment bloodstream infection in hematopoietic SCT recipients. Bone Marrow Transplant. 2014;49(6):824830.

4. Kikuchi M, Akahoshi Y, Nakano H, et al. Risk factors for pre- and post-engraftment bloodstream infections after allogeneic hematopoietic stem cell transplantation. Transpl Infect Dis. 2015;17(1):5665.

5. Mori Y, Yoshimoto G, Nishida R, et al. Gastrointestinal Graft-versus-Host Disease Is a Risk Factor for Postengraftment Bloodstream Infection in Allogeneic Hematopoietic Stem Cell Transplant Recipients. Biol Blood Marrow Transplant. 2018;24(11):23022309.

6. Mikulska M, Raiola AM, Galaverna F, et al. Pre-Engraftment Bloodstream Infections after Allogeneic Hematopoietic Cell Transplantation: impact of T Cell-Replete Transplantation from a Haploidentical Donor. Biol Blood Marrow Transplant. 2018;24(1):109118.

7. Weisser M, Theilacker C, Tschudin Sutter S, et al. Secular trends of bloodstream infections during neutropenia in 15 181 haematopoietic stem cell transplants: 13-year results from a European multicentre surveillance study (ONKO-KISS). Clin Microbiol Infect. 2017;23(11):854859.

8. Poutsiaka DD, Munson D, Price LL, Chan GW, Snydman DR. Blood stream infection (BSI) and acute GVHD after hematopoietic SCT (HSCT) are associated. Bone Marrow Transplant. 2011;46(2):300307.

9. Youssef A, Hafez H, Madney Y, et al. Incidence, risk factors, and outcome of blood stream infections during the first 100 days post-pediatric allogeneic and autologous hematopoietic stem cell transplantations. Pediatr Transplant. 2020;24(1):e13610.

10. Wang CH, Chang FY, Chao TY, et al. Characteristics comparisons of bacteremia in allogeneic and autologous hematopoietic stem cell-transplant recipients with levofloxacin prophylaxis and influence on resistant bacteria emergence. J Microbiol Immunol Infect. 2018;51(1):123131. doi:10.1016/j.jmii.2016.02.003

11. Forcina A, Lorentino F, Marasco V, et al. Clinical Impact of Pretransplant Multidrug-Resistant Gram-Negative Colonization in Autologous and Allogeneic Hematopoietic Stem Cell Transplantation. Biol Blood Marrow Transplant. 2018;24(7):14761482. doi:10.1016/j.bbmt.2018.02.021

12. Averbuch D, Tridello G, Hoek J, et al. Antimicrobial Resistance in Gram-Negative Rods Causing Bacteremia in Hematopoietic Stem Cell Transplant Recipients: intercontinental Prospective Study of the Infectious Diseases Working Party of the European Bone Marrow Transplantation Group. Clin Infect Dis. 2017;65(11):18191828. doi:10.1093/cid/cix646

13. Girmenia C, Rossolini GM, Piciocchi A, et al. Infections by carbapenem-resistant Klebsiella pneumoniae in SCT recipients: a nationwide retrospective survey from Italy. Bone Marrow Transplant. 2015;50(2):282288. doi:10.1038/bmt.2014.231

14. Freifeld AG, Bow EJ, Sepkowitz KA, et al. Clinical practice guideline for the use of antimicrobial agents in neutropenic patients with cancer: 2010 update by the infectious diseases society of america. Clin Infect Dis. 2011;52(4):e5693.

15. Arendrup MC, Prakash A, Meletiadis J, Sharma C, Chowdhary A. Comparison of EUCAST and CLSI Reference Microdilution MICs of Eight Antifungal Compounds for Candida auris and Associated Tentative Epidemiological Cutoff Values. Antimicrob Agents Chemother. 2017;61(6):6. doi:10.1128/AAC.00485-17

16. Han TT, Huang XJ, Liu KY, et al. [Blood stream infections during agranulocytosis period after hematopoietic stem cell transplantation in one single center]. Zhonghua Nei Ke Za Zhi. 2011;50(8):654658.

17. Mikulska M, Del Bono V, Bruzzi P, et al. Mortality after bloodstream infections in allogeneic haematopoietic stem cell transplant (HSCT) recipients. Infection. 2012;40(3):271278. doi:10.1007/s15010-011-0229-y

18. Stoma I, Karpov I, Milanovich N, Uss A, Iskrov I. Risk factors for mortality in patients with bloodstream infections during the pre-engraftment period after hematopoietic stem cell transplantation. Blood Res. 2016;51(2):102106. doi:10.5045/br.2016.51.2.102

19. Stoma I, Littmann ER, Peled JU, et al. Compositional flux within the intestinal microbiota and risk for bloodstream infection with gram-negative bacteria. Clin Infect Dis. 2020. doi:10.1093/cid/ciaa068

20. Puerta-Alcalde P, Cardozo C, Marco F, et al. Changing epidemiology of bloodstream infection in a 25-years hematopoietic stem cell transplant program: current challenges and pitfalls on empiric antibiotic treatment impacting outcomes. Bone Marrow Transplant. 2020;55(3):603612. doi:10.1038/s41409-019-0701-3

21. Blennow O, Ljungman P, Sparrelid E, Mattsson J, Remberger M. Incidence, risk factors, and outcome of bloodstream infections during the pre-engraftment phase in 521 allogeneic hematopoietic stem cell transplantations. Transpl Infect Dis. 2014;16(1):106114. doi:10.1111/tid.12175

22. Liu C-Y, Lai Y-C, Huang L-J, et al. Impact of bloodstream infections on outcome and the influence of prophylactic oral antibiotic regimens in allogeneic hematopoietic SCT recipients. Bone Marrow Transplantation. 2020;55(3):12311239. doi:10.1038/bmt.2010.286

23. Wang L, Wang Y, Fan X, Tang W, Hu J. Prevalence of Resistant Gram-Negative Bacilli in Bloodstream Infection in Febrile Neutropenia Patients Undergoing Hematopoietic Stem Cell Transplantation: A Single Center Retrospective Cohort Study. Medicine. 2014;16(1):e1931. doi:10.1097/MD.0000000000001931

24. Tumbarello M, Viale P, Viscoli C, et al. Predictors of mortality in bloodstream infections caused by Klebsiella pneumoniae carbapenemase-producing K. pneumoniae: importance of combination therapy. Clin Infect Dis. 2012;55(7):943950. doi:10.1093/cid/cis588

25. Qureshi ZA, Paterson DL, Potoski BA, et al. Treatment outcome of bacteremia due to KPC-producing Klebsiella pneumoniae: superiority of combination antimicrobial regimens. Antimicrob Agents Chemother. 2012;56(4):21082113.

26. Zhang R, Liu L, Zhou H, et al. Nationwide Surveillance of Clinical Carbapenem-resistant Enterobacteriaceae (CRE) Strains in China. EBioMedicine. 2017;19:98106.

27. Taur Y, Xavier JB, Lipuma L, et al. Intestinal domination and the risk of bacteremia in patients undergoing allogeneic hematopoietic stem cell transplantation. Clin Infect Dis. 2012;55(7):905914.

28. Mousset S, Buchheidt D, Heinz W, et al. Treatment of invasive fungal infections in cancer patients-updated recommendations of the Infectious Diseases Working Party (AGIHO) of the German Society of Hematology and Oncology (DGHO). Ann Hematol. 2014;93(1):1332.

29. de Naurois J, Novitzky-Basso I, Gill MJ, et al. Management of febrile neutropenia: ESMO Clinical Practice Guidelines. Ann Oncol. 2010;21(Suppl 5):v252256.

30. Mackall C, Fry T, Gress R, et al. Background to hematopoietic cell transplantation, including post transplant immune recovery. Bone Marrow Transplant. 2009;44(8):457462.

31. Ge J, Yang T, Zhang L, et al. The incidence, risk factors and outcomes of early bloodstream infection in patients with malignant hematologic disease after unrelated cord blood transplantation: a retrospective study. BMC Infect Dis. 2018;18(1):654.

32. Laughlin MJ, Eapen M, Rubinstein P, et al. Outcomes after transplantation of cord blood or bone marrow from unrelated donors in adults with leukemia. N Engl J Med. 2004;351(22):22652275.

33. Rocha V, Labopin M, Sanz G, et al. Transplants of umbilical-cord blood or bone marrow from unrelated donors in adults with acute leukemia. N Engl J Med. 2004;351(22):22762285.

Originally posted here:
[Full text] Clinical Analysis of Bloodstream Infections During Agranulocytosis Aft | IDR - Dove Medical Press

To Read More: [Full text] Clinical Analysis of Bloodstream Infections During Agranulocytosis Aft | IDR – Dove Medical Press
categoriaBone Marrow Stem Cells commentoComments Off on [Full text] Clinical Analysis of Bloodstream Infections During Agranulocytosis Aft | IDR – Dove Medical Press | dataJanuary 22nd, 2021
Read All

Page 26«..1020..25262728..4050..»


Copyright :: 2025