Excitement took wing in the scientific community in the early 1990s, when the first gene therapy trial showed significant success, only to crash at the end of the decade with a patients tragic death.

Twenty years later, the excitement is back and greater than before. Although safety remains a concern, investigators are breaking ground in cell and gene therapy, and many believe that ultimately, a string of cured cancers will follow.

In 2017, the excitement over these therapies returned in spades when the FDA signed off on a cell-therapy drug for the first time, approving the chimeric antigen receptor (CAR) T-cell treatment tisagenlecleucel (Kymriah; Novartis) for patients with B-cell precursor acute lymphoblastic leukemia. At last, scientists had devised a way to reprogram a persons own T cells to attack tumor cells.

Were entering a new frontier, said Scott Gottlieb, MD, then-FDA commissioner, in announcing the groundbreaking approval.

Gottlieb was not exaggerating. The growth in CAR T-cell research is exploding. Although only a handful of cell and gene therapies are on the market, the FDA predicted in 2019 that it will receive more than 200 investigational new drug applications per year for cell and gene therapies, and that by 2025, it expects to have accelerated to 10 to 20 cell and gene therapy approvals per year.

We can absolutely cut the number of cancer deaths down so that one day in our lifetimes it can be a rare thing for people to die of cancer, said Patrick Hwu, MD, president and CEO of Moffitt Cancer Center in Florida and among gene therapys pioneers. It still may happen here and there, but itll be kind of like people dying of pneumonia. Its like, He died of pneumonia? Thats kind of weird. I think cancer can be the same way.

Essentially, you can kill any cancer cell that has an antigen that is recognized by the immune cell, Hwu said. The key to curing every single cancer, which is our goal, is to have receptors that can recognize the tumor but dont recognize the normal cells.

Community oncologists will need to be increasingly familiar about the various products, including their immediate and longer-term risks, Bo Wang, MD, and Deepu Madduri, MD, recently wrote in OncologyLive.1 It is key to understand the optimal time for referring these patients to an academic institution, as well as how to manage the requisite post CAR T-cell therapy in the community setting. Madduri is an assistant professor of medicine, hematology and medical oncology, as well as associate director of cellular therapy service, and director of clinical operations with the Center of Excellence for Multiple Myeloma at The Tisch Cancer Institute and the Icahn School of Medicine at Mount Sinai in New York, New York. Wang is a third-year clinical fellow in hematology/oncology at Mount Sinai.

Early referral to academic centers and hospitals equipped to deliver therapies is crucial for patients eligible for therapy. However, as advances continue in the field, community practices may be called upon to administer therapies in their clinic.

The Community Oncology Alliance (COA) envisions a broader role for the settings in which CAR T-cell therapies can be administered. When the Centers for Medicare & Medicaid Services (CMS) was considering coverage for CAR T-cell therapies in 2019, COA officials argued against limiting approvals to hospitals.

It is important to understand that there are state-of-the-art community oncology practices that have significant experience and capabilities in administering highly complex treatments, COA officials wrote in a letter to CMS. For example, stem cell transplants, which are similar in complexity to CAR T therapy, are performed successfully in the community oncology practice setting.2

Broader use of gene therapies depends on several factors, including navigating the logistics of gene therapies, addressing the high costs, and managing toxicities.3

Autologous CAR T-cell therapies involve a manufacturing process that requires coordination between the treating facility and the processing facility. Following leukapheresis, patients may require maintenance therapy to control disease progression during the manufacturing time, which can take 3 to 5 weeks.

In terms of cost, gene and cell therapies can cost from $375,000 to $475,000 per dose and they may face coverage restrictions from payers. Approvals could take weeks to obtain.3,4

Because of cytokine release syndrome and neurotoxicities associated with CAR T-cell therapy, the FDA mandates risk evaluation and mitigation strategy training for centers.

Further, providers may find that real-world experiences with gene therapies are different from those seen in the clinical trial setting, according to Ankit J. Kansagra, MD.

In a presentation at the 2020 American Society of Clinical Oncology Virtual Education Program, Kansagra, an assistant professor of medicine and Eugene P. Frenkel, MD, Scholar in Clinical Medicine at Harold C. Simmons Comprehensive Cancer Center in Dallas, Texas, said that in practice patients may be older and have more aggressive disease, with double- and triple-hit lymphomas.4

Specifically, Kansagra noted that medications such as steroids and/or tocilizumab (Actemra) to prevent or treat cytokine release syndrome or other toxicities were more frequently used in the real-world setting than what had been seen in clinical trials.

As it stands now, only a fraction of eligible patients are receiving CAR T-cell therapies, Kansagra said. Potentially, 9750 patients a year may be eligible for CAR T-cell therapies in approved and upcoming hematologic indications. From 2016 to 2019, a total of 2058 patients received CAR T-cell infusion.4

Next steps for transplanting these novel therapies to clinical practice will require changes in key areas, Kansagra said, such as supply chain management, patient support, and financial systems (Figure).4

Figure. Next Steps for Effective Delivery of Gene and Cell Therapies4

Meanwhile, multiple myeloma experts advise providers to be ready for change. As commercially available myeloma CAR T-cell therapies are approved, it will be even more important for community oncologists to better understand these therapies so they can offer them to their patients, Wang and Madduri wrote.1

Cell therapy involves cultivating or modifying immune cells outside the body before injecting them into the patient. Cells may be autologous (self-provided) or allogeneic (donor-provided); they include hematopoietic stem cells and adult and embryonic stem cells. Gene therapy modifies or manipulates cell expression. There is considerable overlap between the 2 disciplines.

Juliette Hordeaux, PhD, senior director of translational research for the University of Pennsylvanias gene therapy program, is cautious about the FDAs predictions, saying shed be thrilled with 5 cell and/or gene therapy approvals annually.

For monogenic diseases, there are only a certain number of mutations, and then well plateau until we reach a stage where we can go after more common diseases, Hordeaux said.

Safety has been the main brake around adeno-associated virus vector [AAV] gene therapy, added Hordeaux, whose hospitals program has the institutional memory of both Jesse Gelsingers tragic death during a 1999 gene therapy trial as well as breakthroughs by 2015 Giants of Cancer Care winner in immuno-oncology Carl H. June, MD, and others in CAR T-cell therapy. Sometimes there are unexpected toxicity [events] in trials.I think figuring out ways to make gene therapy safer is going to be the next goal for the field before we can even envision many more drugs approved.

In total, 3 CAR T-cell therapies are now on the market, all targeting the CD19 antigen. Tisagenlecleucel was the first. Gilead Sciences received approval in October 2017 for axicabtagene ciloleucel (axi-cel; Yescarta), a CAR T-cell therapy for adults with large B-cell non-Hodgkin lymphoma. Kite Pharma, a subsidiary of Gilead, received an accelerated approval in July 2020 for brexucabtagene autoleucel (Tecartus) for adults with relapsed/ refractory mantle cell lymphoma.

Another CD19-directed therapy under FDA review for relapsed/refractory large B-cell lymphoma, is lisocabtagene maraleucel (liso-cel; JCAR017; Bristol Myers Squibb). Idecabtagene vicleucel (ide-cel; bb2121; Bristol Myers Squibb) is under priority FDA review, with a decision expected by March 31, 2021. The biologics license application for ide-cel seeks approval for the B-cell maturation antigendirected CAR therapy to treat adult patients with multiple myeloma who have received at least 3 prior therapies.5

The number of clinical trials evaluating CAR T-cell therapies has risen sharply since 2015, when investigators counted a total of 78 studies registered on the ClinicalTrials. gov website. In June 2020, the site listed 671 trials, including 357 registered in China, 256 in the United States, and 58 in other countries.6 Natural killer (NK) cells are the research focus of Dean A. Lee, MD, PhD, a physician in the Division of Hematology and Oncology at Nationwide Childrens Hospital in Columbus, Ohio. He developed a method for consistent, robust expansion of highly active clinical-grade NK cells that enables repeated delivery of large cell doses for improved efficacy. This finding led to several first-in-human clinical trials evaluating adoptive immunotherapy with expanded NK cells under an FDA investigational new drug application. Lee is developing both genetic and nongenetic methods to improve tumor targeting and tissue homing of NK cells. His efforts are geared toward pediatric sarcomas.

The biggest emphasis over the past 20 to 25 years has been cell therapy for cancer, talking about trying to transfer a specific part of the immune system for cells, said Lee, who is also director of the Cellular Therapy and Cancer Immunology Program at Nationwide Childrens Hospital, at The Ohio State University Comprehensive Cancer Center Arthur G. James Cancer Hospital, and at the Richard J. Solove Research Institute.

However, Lee said, NKs have wider potential. This is kind of a natural swing back. Now that we know we can grow them, we can reengineer them against infectious disease targets and use them in that [space], he said.

Lee is part of a coronavirus disease 2019 (COVID-19) clinical trial, partnering with Kiadis, for off-the-shelf K-NK cells using Kiadis proprietary platforms. Such treatment would be a postexposure preemptive therapy for treating COVID-19. Lee said the pivot toward treating COVID19 with cell therapy was because some of the very early reports on immune responses to coronavirus, both original [SARS-CoV-2] and the new [mutation], seem to implicate that those who did poorly [overall] had poorly functioning NK cells.

The revolutionary gene editing tool CRISPR is making its initial impact in clinical trials outside the cancer area. Its developers, Jennifer Doudna, PhD, and Emmanuelle Charpentier, PhD, won the Nobel Prize in Chemistry 2020.

For patients with sickle cell disease (SCD), CRISPR was used to reengineer bone marrow cells to produce fetal hemoglobin, with the hope that the protein would turn deformed red blood cells into healthy ones. National Public Radio (NPR) did a story on one patient who, so far, thanks to CRISPR, has been liberated from the attacks of SCD that typically have sent her to the hospital, as well from the need for blood transfusions.7

Its a miracle, you know? the patient, Victoria Gray of Forest, Mississippi, told NPR.

She was among 10 patients with SCD or transfusion-dependent beta-thalassemia treated with promising results, as reported by the New England Journal of Medicine.8

Stephen Gottschalk, MD, chair of the department of bone marrow transplantation and cellular therapy at St Jude Childrens Research Hospital, said, Theres a lot of activity to really explore these therapies with diseases that are much more common than cancer.

Animal models use T cells to reverse cardiac fibrosis, for instance, Gottschalk said. Using T cells to reverse pathologies associated with senescence, such as conditions associated with inflammatory clots, are also being studied.

CAR T, I think, will become part of the standard of care, Gottschalk said. The question is how to best get that accomplished. To address the tribulations of some autologous products, a lot of groups are working with off-the-shelf products to get around some of the manufacturing bottlenecks. I believe those issues will be solved in the long run.

Read this article:
Harnessing the Potential of Cell and Gene Therapy - OncLive

Gaining more fat cells is probably not what most people want, although that might be exactly what they need to fight off diabetes and other diseases. How and where the body can add fat cells has remained a mystery - but two new studies from UT Southwestern provide answers on the way this process works.

The studies, both published online in Cell Stem Cell, describe two different processes that affect the generation of new fat cells. One reports how fat cell creation is impacted by the level of activity in tiny organelles inside cells called mitochondria. The other outlines a process that prevents new fat cells from developing in one fat storage area in mice - the area that correlates with the healthy subcutaneous fat just under the skin in humans. (Both studies were done in mice.)

In the second study, a commonly used cancer drug was able to jump-start healthy fat cell creation in mice, a finding that raises the possibility of future drug treatments for humans.

While fat isn't popular, as long as people overeat they will need a place to store the excess calories, explains Philipp Scherer, Ph.D., director of the Touchstone Center for Diabetes Research at UT Southwestern and senior author of the first study focusing on mitochondria. There are two options, he says: squeezing more lipids (fat) into existing fat cells and ballooning their size, leading to problems such as inflammation and, eventually, diabetes; or creating new fat cells to help spread the load. Fat stored properly - in fat cell layers under the skin (subcutaneous fat) that aren't overburdened instead of around organs (visceral fat) or even inside organs - is the healthy alternative, he says.

Problems follow if existing fat cells are left on their own to become engorged, adds Rana Gupta, Ph.D., associate professor of internal medicine and senior author of the second study. "When these cells are so overwhelmed that they can't take it anymore, they eventually die or become dysfunctional, spilling lipids into places not intended to store fat."

Those lipids may move into the liver, leading to fatty liver disease; to the pancreas, resulting in diabetes; or even to the heart, causing cardiovascular disease, Gupta says. Visceral, or belly fat, may surround the organs, creating inflammation.

The healthiest place to store fat is in subcutaneous fat, adds Gupta. Ironically, that is where mice in his study were least able to create new fat cells, despite the fact that stem-cell-like progenitor cells primed to become fat cells were present there as well, he says.

Gupta's study identified a process that prevents progenitor cells from developing into fat cells in mouse subcutaneous inguinal fat.

The protein HIF-1a (short for hypoxia-inducible factor-1 alpha) is central to the process. It kicks off a series of cellular actions that ultimately inactivate a second protein called PPARgamma, the key driver of fat cell formation.

These proteins are found in both humans and mice. In fact, in a culture of human subcutaneous fat cell progenitors, HIF-1a also inhibited new fat cells from being created, according to Gupta.

In Gupta's mouse study, researchers used a genetic approach to inhibit HIF-1a and found that the progenitor cells could then make subcutaneous inguinal fat cells and fewer were inflamed or fibrotic.

Next, they tested the cancer drug imatinib (brand name Gleevec) and found it had the same effect. The cancer drug was tried because it was known to have beneficial effects against diabetes in cancer patients with both diseases, Gupta says.

In Scherer's study, researchers manipulated a protein called MitoNEET in the outer membrane of the precursor cells' mitochondria, organelles known as the cells' power plants. The resulting mitochondrial dysfunction and drop in cell metabolism caused precursor cells to lose the ability to become new fat cells and increased inflammation.

"This study shows we can manipulate the precursor cells' willingness to become fat cells," Scherer says. "The ability to recruit new fat cells by tickling these pre-fat cells to become fat cells is very important and has profound beneficial effects on health, particularly in the obesity-prone environment that we all live in."

He says his goal is now to design a drug that could stimulate mitochondrial activity.

"Understanding the mechanism is an important first step," Scherer says, referring to the findings from the two studies. "We will have to learn in the future how to manipulate these processes pharmacologically."

Reference: Joffin N, Paschoal VA, Gliniak CM, et aI. Mitochondrial metabolism is a key regulator of the fibro-inflammatory and adipogenic stromal subpopulations in white adipose tissue. Cell Stem Cell. doi:doi.org/10.1016/j.stem.2021.01.002

This article has been republished from the following materials. Note: material may have been edited for length and content. For further information, please contact the cited source.

See the original post here:
Two Studies Shed Light on How and Where the Body Can Add New Fat Cells - Technology Networks

CAMBRIDGE, Mass., Feb. 03, 2021 (GLOBE NEWSWIRE) -- Rubius Therapeutics, Inc. (Nasdaq: RUBY), a clinical-stage biopharmaceutical company that is genetically engineering red blood cells to create an entirely new class of cellular medicines called Red Cell Therapeutics™, today announced that Pablo J. Cagnoni, M.D., president and chief executive officer, and the executive management team will participate in a fireside chat at the Guggenheim Healthcare Talks | 2021 Oncology Days on February 11, 2021, at 2:30 p.m. EST.

Here is the original post:
Rubius Therapeutics to Participate in Guggenheim Healthcare Talks | 2021 Oncology Days

KENILWORTH, N.J.--(BUSINESS WIRE)--Merck (NYSE: MRK), known as MSD outside the United States and Canada, today announced that the Committee for Medicinal Products for Human Use (CHMP) of the European Medicines Agency (EMA) has adopted a positive opinion recommending approval of an expanded label for KEYTRUDA, Mercks anti-PD-1 therapy. The opinion is recommending KEYTRUDA as monotherapy for the treatment of adult and pediatric patients aged 3 years and older with relapsed or refractory classical Hodgkin lymphoma (cHL) who have failed autologous stem cell transplant (ASCT) or following at least two prior therapies when ASCT is not a treatment option.

This recommendation is based on results from the pivotal Phase 3 KEYNOTE-204 trial, in which KEYTRUDA monotherapy demonstrated a significant improvement in progression-free survival (PFS) compared with brentuximab vedotin (BV), a commonly used treatment. KEYTRUDA reduced the risk of disease progression or death by 35% (HR=0.65 [95% CI, 0.48-0.88]; p=0.00271) and showed a median PFS of 13.2 months versus 8.3 months for patients treated with BV. The recommendation is also based on supportive data from an updated analysis of the KEYNOTE-087 trial, which supported the European Commissions (EC) approval of KEYTRUDA for the treatment of adult patients with relapsed or refractory cHL who have failed ASCT and BV or who are transplant ineligible and have failed BV. The CHMPs recommendation will now be reviewed by the EC for marketing authorization in the European Union (EU), and a final decision is expected in the first quarter of 2021. If approved, this will be the first pediatric indication for KEYTRUDA in the EU.

This positive opinion reinforces the importance of KEYTRUDA for certain adult and pediatric patients with relapsed or refractory classical Hodgkin lymphoma in the European Union, said Dr. Vicki Goodman, vice president, clinical research, Merck Research Laboratories. We look forward to the decision by the European Commission and will continue to expand our clinical development program in blood cancers with KEYTRUDA and our recently acquired investigational therapies to help address the unmet needs of patients.

Merck is studying KEYTRUDA across hematologic malignancies through a broad clinical program, including multiple registrational trials in cHL and primary mediastinal large B-cell lymphoma and more than 60 investigator-initiated studies across 15 tumors. In addition to KEYTRUDA, Merck is evaluating two clinical-stage assets for the treatment of patients with hematologic malignancies: MK-1026 (formerly ARQ 531), a Brutons tyrosine kinase inhibitor, and VLS-101, an antibody-drug conjugate targeting ROR1.

About KEYNOTE-204

KEYNOTE-204 (ClinicalTrials.gov, NCT02684292) is a randomized, open-label, Phase 3 trial evaluating KEYTRUDA monotherapy compared with BV for the treatment of patients with relapsed or refractory cHL. The primary endpoints are PFS and overall survival (OS), and the secondary endpoints include objective response rate (ORR), complete remission rate (CRR) and safety. The study enrolled 304 patients, aged 18 years and older, who were randomized to receive either:

About Hodgkin Lymphoma

Hodgkin lymphoma is a type of lymphoma that develops in the white blood cells called lymphocytes, which are part of the immune system. Hodgkin lymphoma can start almost anywhere most often in lymph nodes in the upper part of the body, with the most common sites being in the chest, neck or under the arms. Worldwide, there were approximately 83,000 new cases of Hodgkin lymphoma diagnosed, and more than 23,000 people died from the disease in 2020. In the EU, there were nearly 20,000 new cases of Hodgkin lymphoma diagnosed, and nearly 4,000 people died from the disease in 2020. Classical Hodgkin lymphoma accounts for more than nine in 10 cases of Hodgkin lymphoma in developed countries.

About KEYTRUDA (pembrolizumab) Injection, 100 mg

KEYTRUDA is an anti-PD-1 therapy that works by increasing the ability of the bodys immune system to help detect and fight tumor cells. KEYTRUDA is a humanized monoclonal antibody that blocks the interaction between PD-1 and its ligands, PD-L1 and PD-L2, thereby activating T lymphocytes which may affect both tumor cells and healthy cells.

Merck has the industrys largest immuno-oncology clinical research program. There are currently more than 1,300 trials studying KEYTRUDA across a wide variety of cancers and treatment settings. The KEYTRUDA clinical program seeks to understand the role of KEYTRUDA across cancers and the factors that may predict a patient's likelihood of benefitting from treatment with KEYTRUDA, including exploring several different biomarkers.

Selected KEYTRUDA (pembrolizumab) Indications in the U.S.

Melanoma

KEYTRUDA is indicated for the treatment of patients with unresectable or metastatic melanoma.

KEYTRUDA is indicated for the adjuvant treatment of patients with melanoma with involvement of lymph node(s) following complete resection.

Non-Small Cell Lung Cancer

KEYTRUDA, in combination with pemetrexed and platinum chemotherapy, is indicated for the first-line treatment of patients with metastatic nonsquamous non-small cell lung cancer (NSCLC), with no EGFR or ALK genomic tumor aberrations.

KEYTRUDA, in combination with carboplatin and either paclitaxel or paclitaxel protein-bound, is indicated for the first-line treatment of patients with metastatic squamous NSCLC.

KEYTRUDA, as a single agent, is indicated for the first-line treatment of patients with NSCLC expressing PD-L1 [tumor proportion score (TPS) 1%] as determined by an FDA-approved test, with no EGFR or ALK genomic tumor aberrations, and is stage III where patients are not candidates for surgical resection or definitive chemoradiation, or metastatic.

KEYTRUDA, as a single agent, is indicated for the treatment of patients with metastatic NSCLC whose tumors express PD-L1 (TPS 1%) as determined by an FDA-approved test, with disease progression on or after platinum-containing chemotherapy. Patients with EGFR or ALK genomic tumor aberrations should have disease progression on FDA-approved therapy for these aberrations prior to receiving KEYTRUDA.

Small Cell Lung Cancer

KEYTRUDA is indicated for the treatment of patients with metastatic small cell lung cancer (SCLC) with disease progression on or after platinum-based chemotherapy and at least 1 other prior line of therapy. This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in confirmatory trials.

Head and Neck Squamous Cell Cancer

KEYTRUDA, in combination with platinum and fluorouracil (FU), is indicated for the first-line treatment of patients with metastatic or with unresectable, recurrent head and neck squamous cell carcinoma (HNSCC).

KEYTRUDA, as a single agent, is indicated for the first-line treatment of patients with metastatic or with unresectable, recurrent HNSCC whose tumors express PD-L1 [combined positive score (CPS) 1] as determined by an FDA-approved test.

KEYTRUDA, as a single agent, is indicated for the treatment of patients with recurrent or metastatic HNSCC with disease progression on or after platinum-containing chemotherapy.

Classical Hodgkin Lymphoma

KEYTRUDA is indicated for the treatment of adult patients with relapsed or refractory classical Hodgkin lymphoma (cHL).

KEYTRUDA is indicated for the treatment of pediatric patients with refractory cHL, or cHL that has relapsed after 2 or more lines of therapy.

Primary Mediastinal Large B-Cell Lymphoma

KEYTRUDA is indicated for the treatment of adult and pediatric patients with refractory primary mediastinal large B-cell lymphoma (PMBCL), or who have relapsed after 2 or more prior lines of therapy. KEYTRUDA is not recommended for treatment of patients with PMBCL who require urgent cytoreductive therapy.

Urothelial Carcinoma

KEYTRUDA is indicated for the treatment of patients with locally advanced or metastatic urothelial carcinoma (mUC) who are not eligible for cisplatin-containing chemotherapy and whose tumors express PD-L1 (CPS 10), as determined by an FDA-approved test, or in patients who are not eligible for any platinum-containing chemotherapy regardless of PD-L1 status. This indication is approved under accelerated approval based on tumor response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in confirmatory trials.

KEYTRUDA is indicated for the treatment of patients with locally advanced or metastatic urothelial carcinoma (mUC) who have disease progression during or following platinum-containing chemotherapy or within 12 months of neoadjuvant or adjuvant treatment with platinum-containing chemotherapy.

KEYTRUDA is indicated for the treatment of patients with Bacillus Calmette-Guerin (BCG)-unresponsive, high-risk, non-muscle invasive bladder cancer (NMIBC) with carcinoma in situ (CIS) with or without papillary tumors who are ineligible for or have elected not to undergo cystectomy.

Microsatellite Instability-High or Mismatch Repair Deficient Cancer

KEYTRUDA is indicated for the treatment of adult and pediatric patients with unresectable or metastatic microsatellite instability-high (MSI-H) or mismatch repair deficient (dMMR)

This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials. The safety and effectiveness of KEYTRUDA in pediatric patients with MSI-H central nervous system cancers have not been established.

Microsatellite Instability-High or Mismatch Repair Deficient Colorectal Cancer

KEYTRUDA is indicated for the first-line treatment of patients with unresectable or metastatic MSI-H or dMMR colorectal cancer (CRC).

Gastric Cancer

KEYTRUDA is indicated for the treatment of patients with recurrent locally advanced or metastatic gastric or gastroesophageal junction (GEJ) adenocarcinoma whose tumors express PD-L1 (CPS 1) as determined by an FDA-approved test, with disease progression on or after two or more prior lines of therapy including fluoropyrimidine- and platinum-containing chemotherapy and if appropriate, HER2/neu-targeted therapy. This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials.

Esophageal Cancer

KEYTRUDA is indicated for the treatment of patients with recurrent locally advanced or metastatic squamous cell carcinoma of the esophagus whose tumors express PD-L1 (CPS 10) as determined by an FDA-approved test, with disease progression after one or more prior lines of systemic therapy.

Cervical Cancer

KEYTRUDA is indicated for the treatment of patients with recurrent or metastatic cervical cancer with disease progression on or after chemotherapy whose tumors express PD-L1 (CPS 1) as determined by an FDA-approved test. This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials.

Hepatocellular Carcinoma

KEYTRUDA is indicated for the treatment of patients with hepatocellular carcinoma (HCC) who have been previously treated with sorafenib. This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials.

Merkel Cell Carcinoma

KEYTRUDA is indicated for the treatment of adult and pediatric patients with recurrent locally advanced or metastatic Merkel cell carcinoma (MCC). This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials.

Renal Cell Carcinoma

KEYTRUDA, in combination with axitinib, is indicated for the first-line treatment of patients with advanced renal cell carcinoma (RCC).

Tumor Mutational Burden-High

KEYTRUDA is indicated for the treatment of adult and pediatric patients with unresectable or metastatic tumor mutational burden-high (TMB-H) [10 mutations/megabase] solid tumors, as determined by an FDA-approved test, that have progressed following prior treatment and who have no satisfactory alternative treatment options. This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials. The safety and effectiveness of KEYTRUDA in pediatric patients with TMB-H central nervous system cancers have not been established.

Cutaneous Squamous Cell Carcinoma

KEYTRUDA is indicated for the treatment of patients with recurrent or metastatic cutaneous squamous cell carcinoma (cSCC) that is not curable by surgery or radiation.

Triple-Negative Breast Cancer

KEYTRUDA, in combination with chemotherapy, is indicated for the treatment of patients with locally recurrent unresectable or metastatic triple-negative breast cancer (TNBC) whose tumors express PD-L1 (CPS 10) as determined by an FDA-approved test. This indication is approved under accelerated approval based on progression-free survival. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials.

Selected Important Safety Information for KEYTRUDA

Severe and Fatal Immune-Mediated Adverse Reactions

KEYTRUDA is a monoclonal antibody that belongs to a class of drugs that bind to either the programmed death receptor-1 (PD-1) or the programmed death ligand 1 (PD-L1), blocking the PD-1/PD-L1 pathway, thereby removing inhibition of the immune response, potentially breaking peripheral tolerance and inducing immune-mediated adverse reactions. Immune-mediated adverse reactions, which may be severe or fatal, can occur in any organ system or tissue, can affect more than one body system simultaneously, and can occur at any time after starting treatment or after discontinuation of treatment. Important immune-mediated adverse reactions listed here may not include all possible severe and fatal immune-mediated adverse reactions.

Monitor patients closely for symptoms and signs that may be clinical manifestations of underlying immune-mediated adverse reactions. Early identification and management are essential to ensure safe use of antiPD-1/PD-L1 treatments. Evaluate liver enzymes, creatinine, and thyroid function at baseline and periodically during treatment. In cases of suspected immune-mediated adverse reactions, initiate appropriate workup to exclude alternative etiologies, including infection. Institute medical management promptly, including specialty consultation as appropriate.

Withhold or permanently discontinue KEYTRUDA depending on severity of the immune-mediated adverse reaction. In general, if KEYTRUDA requires interruption or discontinuation, administer systemic corticosteroid therapy (1 to 2 mg/kg/day prednisone or equivalent) until improvement to Grade 1 or less. Upon improvement to Grade 1 or less, initiate corticosteroid taper and continue to taper over at least 1 month. Consider administration of other systemic immunosuppressants in patients whose adverse reactions are not controlled with corticosteroid therapy.

Immune-Mediated Pneumonitis

KEYTRUDA can cause immune-mediated pneumonitis. The incidence is higher in patients who have received prior thoracic radiation. Immune-mediated pneumonitis occurred in 3.4% (94/2799) of patients receiving KEYTRUDA, including fatal (0.1%), Grade 4 (0.3%), Grade 3 (0.9%), and Grade 2 (1.3%) reactions. Systemic corticosteroids were required in 67% (63/94) of patients. Pneumonitis led to permanent discontinuation of KEYTRUDA in 1.3% (36) and withholding in 0.9% (26) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement; of these, 23% had recurrence. Pneumonitis resolved in 59% of the 94 patients.

Pneumonitis occurred in 8% (31/389) of adult patients with cHL receiving KEYTRUDA as a single agent, including Grades 3-4 in 2.3% of patients. Patients received high-dose corticosteroids for a median duration of 10 days (range: 2 days to 53 months). Pneumonitis rates were similar in patients with and without prior thoracic radiation. Pneumonitis led to discontinuation of KEYTRUDA in 5.4% (21) of patients. Of the patients who developed pneumonitis, 42% of these patients interrupted KEYTRUDA, 68% discontinued KEYTRUDA, and 77% had resolution.

Immune-Mediated Colitis

KEYTRUDA can cause immune-mediated colitis, which may present with diarrhea. Cytomegalovirus infection/reactivation has been reported in patients with corticosteroid-refractory immune-mediated colitis. In cases of corticosteroid-refractory colitis, consider repeating infectious workup to exclude alternative etiologies. Immune-mediated colitis occurred in 1.7% (48/2799) of patients receiving KEYTRUDA, including Grade 4 (<0.1%), Grade 3 (1.1%), and Grade 2 (0.4%) reactions. Systemic corticosteroids were required in 69% (33/48); additional immunosuppressant therapy was required in 4.2% of patients. Colitis led to permanent discontinuation of KEYTRUDA in 0.5% (15) and withholding in 0.5% (13) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement; of these, 23% had recurrence. Colitis resolved in 85% of the 48 patients.

Hepatotoxicity and Immune-Mediated Hepatitis

KEYTRUDA as a Single Agent

KEYTRUDA can cause immune-mediated hepatitis. Immune-mediated hepatitis occurred in 0.7% (19/2799) of patients receiving KEYTRUDA, including Grade 4 (<0.1%), Grade 3 (0.4%), and Grade 2 (0.1%) reactions. Systemic corticosteroids were required in 68% (13/19) of patients; additional immunosuppressant therapy was required in 11% of patients. Hepatitis led to permanent discontinuation of KEYTRUDA in 0.2% (6) and withholding in 0.3% (9) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement; of these, none had recurrence. Hepatitis resolved in 79% of the 19 patients.

KEYTRUDA with Axitinib

KEYTRUDA in combination with axitinib can cause hepatic toxicity. Monitor liver enzymes before initiation of and periodically throughout treatment. Consider monitoring more frequently as compared to when the drugs are administered as single agents. For elevated liver enzymes, interrupt KEYTRUDA and axitinib, and consider administering corticosteroids as needed. With the combination of KEYTRUDA and axitinib, Grades 3 and 4 increased alanine aminotransferase (ALT) (20%) and increased aspartate aminotransferase (AST) (13%) were seen, which was at a higher frequency compared to KEYTRUDA alone. Fifty-nine percent of the patients with increased ALT received systemic corticosteroids. In patients with ALT 3 times upper limit of normal (ULN) (Grades 2-4, n=116), ALT resolved to Grades 0-1 in 94%. Among the 92 patients who were rechallenged with either KEYTRUDA (n=3) or axitinib (n=34) administered as a single agent or with both (n=55), recurrence of ALT 3 times ULN was observed in 1 patient receiving KEYTRUDA, 16 patients receiving axitinib, and 24 patients receiving both. All patients with a recurrence of ALT 3 ULN subsequently recovered from the event.

Immune-Mediated Endocrinopathies

Adrenal Insufficiency

KEYTRUDA can cause primary or secondary adrenal insufficiency. For Grade 2 or higher, initiate symptomatic treatment, including hormone replacement as clinically indicated. Withhold KEYTRUDA depending on severity. Adrenal insufficiency occurred in 0.8% (22/2799) of patients receiving KEYTRUDA, including Grade 4 (<0.1%), Grade 3 (0.3%), and Grade 2 (0.3%) reactions. Systemic corticosteroids were required in 77% (17/22) of patients; of these, the majority remained on systemic corticosteroids. Adrenal insufficiency led to permanent discontinuation of KEYTRUDA in <0.1% (1) and withholding in 0.3% (8) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement.

Hypophysitis

KEYTRUDA can cause immune-mediated hypophysitis. Hypophysitis can present with acute symptoms associated with mass effect such as headache, photophobia, or visual field defects. Hypophysitis can cause hypopituitarism. Initiate hormone replacement as indicated. Withhold or permanently discontinue KEYTRUDA depending on severity. Hypophysitis occurred in 0.6% (17/2799) of patients receiving KEYTRUDA, including Grade 4 (<0.1%), Grade 3 (0.3%), and Grade 2 (0.2%) reactions. Systemic corticosteroids were required in 94% (16/17) of patients; of these, the majority remained on systemic corticosteroids. Hypophysitis led to permanent discontinuation of KEYTRUDA in 0.1% (4) and withholding in 0.3% (7) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement.

Thyroid Disorders

KEYTRUDA can cause immune-mediated thyroid disorders. Thyroiditis can present with or without endocrinopathy. Hypothyroidism can follow hyperthyroidism. Initiate hormone replacement for hypothyroidism or institute medical management of hyperthyroidism as clinically indicated. Withhold or permanently discontinue KEYTRUDA depending on severity. Thyroiditis occurred in 0.6% (16/2799) of patients receiving KEYTRUDA, including Grade 2 (0.3%). None discontinued, but KEYTRUDA was withheld in <0.1% (1) of patients.

Hyperthyroidism occurred in 3.4% (96/2799) of patients receiving KEYTRUDA, including Grade 3 (0.1%) and Grade 2 (0.8%). It led to permanent discontinuation of KEYTRUDA in <0.1% (2) and withholding in 0.3% (7) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement. Hypothyroidism occurred in 8% (237/2799) of patients receiving KEYTRUDA, including Grade 3 (0.1%) and Grade 2 (6.2%). It led to permanent discontinuation of KEYTRUDA in <0.1% (1) and withholding in 0.5% (14) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement. The majority of patients with hypothyroidism required long-term thyroid hormone replacement. The incidence of new or worsening hypothyroidism was higher in 1185 patients with HNSCC, occurring in 16% of patients receiving KEYTRUDA as a single agent or in combination with platinum and FU, including Grade 3 (0.3%) hypothyroidism. The incidence of new or worsening hypothyroidism was higher in 389 adult patients with cHL (17%) receiving KEYTRUDA as a single agent, including Grade 1 (6.2%) and Grade 2 (10.8%) hypothyroidism.

Type 1 Diabetes Mellitus (DM), Which Can Present With Diabetic Ketoacidosis

Monitor patients for hyperglycemia or other signs and symptoms of diabetes. Initiate treatment with insulin as clinically indicated. Withhold KEYTRUDA depending on severity. Type 1 DM occurred in 0.2% (6/2799) of patients receiving KEYTRUDA. It led to permanent discontinuation in <0.1% (1) and withholding of KEYTRUDA in <0.1% (1). All patients who were withheld reinitiated KEYTRUDA after symptom improvement.

Immune-Mediated Nephritis With Renal Dysfunction

KEYTRUDA can cause immune-mediated nephritis. Immune-mediated nephritis occurred in 0.3% (9/2799) of patients receiving KEYTRUDA, including Grade 4 (<0.1%), Grade 3 (0.1%), and Grade 2 (0.1%) reactions. Systemic corticosteroids were required in 89% (8/9) of patients. Nephritis led to permanent discontinuation of KEYTRUDA in 0.1% (3) and withholding in 0.1% (3) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement; of these, none had recurrence. Nephritis resolved in 56% of the 9 patients.

Immune-Mediated Dermatologic Adverse Reactions

KEYTRUDA can cause immune-mediated rash or dermatitis. Exfoliative dermatitis, including Stevens-Johnson syndrome, drug rash with eosinophilia and systemic symptoms, and toxic epidermal necrolysis, has occurred with antiPD-1/PD-L1 treatments. Topical emollients and/or topical corticosteroids may be adequate to treat mild to moderate nonexfoliative rashes. Withhold or permanently discontinue KEYTRUDA depending on severity. Immune-mediated dermatologic adverse reactions occurred in 1.4% (38/2799) of patients receiving KEYTRUDA, including Grade 3 (1%) and Grade 2 (0.1%) reactions. Systemic corticosteroids were required in 40% (15/38) of patients. These reactions led to permanent discontinuation in 0.1% (2) and withholding of KEYTRUDA in 0.6% (16) of patients. All patients who were withheld reinitiated KEYTRUDA after symptom improvement; of these, 6% had recurrence. The reactions resolved in 79% of the 38 patients.

Other Immune-Mediated Adverse Reactions

The following clinically significant immune-mediated adverse reactions occurred at an incidence of <1% (unless otherwise noted) in patients who received KEYTRUDA or were reported with the use of other antiPD-1/PD-L1 treatments. Severe or fatal cases have been reported for some of these adverse reactions. Cardiac/Vascular: Myocarditis, pericarditis, vasculitis; Nervous System: Meningitis, encephalitis, myelitis and demyelination, myasthenic syndrome/myasthenia gravis (including exacerbation), Guillain-Barr syndrome, nerve paresis, autoimmune neuropathy; Ocular: Uveitis, iritis and other ocular inflammatory toxicities can occur. Some cases can be associated with retinal detachment. Various grades of visual impairment, including blindness, can occur. If uveitis occurs in combination with other immune-mediated adverse reactions, consider a Vogt-Koyanagi-Harada-like syndrome, as this may require treatment with systemic steroids to reduce the risk of permanent vision loss; Gastrointestinal: Pancreatitis, to include increases in serum amylase and lipase levels, gastritis, duodenitis; Musculoskeletal and Connective Tissue: Myositis/polymyositis rhabdomyolysis (and associated sequelae, including renal failure), arthritis (1.5%), polymyalgia rheumatica; Endocrine: Hypoparathyroidism; Hematologic/Immune: Hemolytic anemia, aplastic anemia, hemophagocytic lymphohistiocytosis, systemic inflammatory response syndrome, histiocytic necrotizing lymphadenitis (Kikuchi lymphadenitis), sarcoidosis, immune thrombocytopenic purpura, solid organ transplant rejection.

Infusion-Related Reactions

KEYTRUDA can cause severe or life-threatening infusion-related reactions, including hypersensitivity and anaphylaxis, which have been reported in 0.2% of 2799 patients receiving KEYTRUDA. Monitor for signs and symptoms of infusion-related reactions. Interrupt or slow the rate of infusion for Grade 1 or Grade 2 reactions. For Grade 3 or Grade 4 reactions, stop infusion and permanently discontinue KEYTRUDA.

Complications of Allogeneic Hematopoietic Stem Cell Transplantation (HSCT)

Fatal and other serious complications can occur in patients who receive allogeneic HSCT before or after antiPD-1/PD-L1 treatment. Transplant-related complications include hyperacute graft-versus-host disease (GVHD), acute and chronic GVHD, hepatic veno-occlusive disease after reduced intensity conditioning, and steroid-requiring febrile syndrome (without an identified infectious cause). These complications may occur despite intervening therapy between antiPD-1/PD-L1 treatment and allogeneic HSCT. Follow patients closely for evidence of these complications and intervene promptly. Consider the benefit vs risks of using antiPD-1/PD-L1 treatments prior to or after an allogeneic HSCT.

Increased Mortality in Patients With Multiple Myeloma

In trials in patients with multiple myeloma, the addition of KEYTRUDA to a thalidomide analogue plus dexamethasone resulted in increased mortality. Treatment of these patients with an antiPD-1/PD-L1 treatment in this combination is not recommended outside of controlled trials.

Embryofetal Toxicity

Based on its mechanism of action, KEYTRUDA can cause fetal harm when administered to a pregnant woman. Advise women of this potential risk. In females of reproductive potential, verify pregnancy status prior to initiating KEYTRUDA and advise them to use effective contraception during treatment and for 4 months after the last dose.

Adverse Reactions

In KEYNOTE-006, KEYTRUDA was discontinued due to adverse reactions in 9% of 555 patients with advanced melanoma; adverse reactions leading to permanent discontinuation in more than one patient were colitis (1.4%), autoimmune hepatitis (0.7%), allergic reaction (0.4%), polyneuropathy (0.4%), and cardiac failure (0.4%). The most common adverse reactions (20%) with KEYTRUDA were fatigue (28%), diarrhea (26%), rash (24%), and nausea (21%).

In KEYNOTE-054, KEYTRUDA was permanently discontinued due to adverse reactions in 14% of 509 patients; the most common (1%) were pneumonitis (1.4%), colitis (1.2%), and diarrhea (1%). Serious adverse reactions occurred in 25% of patients receiving KEYTRUDA. The most common adverse reaction (20%) with KEYTRUDA was diarrhea (28%).

View post:
Merck Receives Positive EU CHMP Opinion for Expanded Approval of KEYTRUDA (pembrolizumab) in Certain Patients With Relapsed or Refractory Classical...

Newswise PHILADELPHIAScientists in the Perelman School of Medicine at the University of Pennsylvania have uncovered the molecular causes of a congenital form of dilated cardiomyopathy (DCM), an often-fatal heart disorder.

This inherited form of DCM which affects at least several thousand people in the United States at any one time and often causes sudden death or progressive heart failure is one of multiple congenital disorders known to be caused by inherited mutations in a gene called LMNA. The LMNA gene is active in most cell types, and researchers have not understood why LMNA mutations affect particular organs such as the heart while sparing most other organs and tissues.

In the study, published this week in Cell Stem Cell, the Penn Medicine scientists used stem cell techniques to grow human heart muscle cells containing DCM-causing mutations in LMNA. They found that these mutations severely disrupt the structural organization of DNA in the nucleus of heart muscle cells but not two other cell types studied leading to the abnormal activation of non-heart muscle genes.

Were now beginning to understand why patients with LMNA mutations have tissue-restricted disorders such as DCM even though the gene is expressed in most cell types, said study co-senior author Rajan Jain, MD, an assistant professor of Cardiovascular Medicine and Cell and Developmental Biology at the Perelman School of Medicine.

Further work along these lines should enable us to predict how LMNA mutations will manifest in individual patients, and ultimately we may be able to intervene with drugs to correct the genome disorganization that these mutations cause, said study co-senior author Kiran Musunuru, MD, PhD, a professor of Cardiovascular Medicine and Genetics, and Director of the Genetic and Epigenetic Origins of Disease Program at Penn Medicine.

Inherited LMNA mutations have long puzzled researchers. The LMNA gene encodes proteins that form a lacy structure on the inner wall of the cell nucleus, where chromosomes full of coiled DNA are housed. This lacy structure, known as the nuclear lamina, touches some parts of the genome, and these lamina-genome interactions help regulate gene activity, for example in the process of cell division. The puzzle is that the nuclear lamina is found in most cell types, yet the disruption of this important and near-ubiquitous cellular component by LMNA mutations causes only a handful of relatively specific clinical disorders, including a form of DCM, two forms of muscular dystrophy, and a form of progeria a syndrome that resembles rapid aging.

To better understand how LMNA mutations can cause DCM, Jain, Musunuru, and their colleagues took cells from a healthy human donor, and used the CRISPR gene-editing technique to create known DCM-causing LMNA mutations in each cell. They then used stem cell methods to turn these cells into heart muscle cells cardiomyocytes and, for comparison, liver and fat cells. Their goal was to discover what was happening in the mutation-containing cardiomyocytes that wasnt happening in the other cell types.

The researchers found that in the LMNA-mutant cardiomyocytes but hardly at all in the other two cell types the nuclear lamina had an altered appearance and did not connect to the genome in the usual way. This disruption of lamina-genome interactions led to a failure of normal gene regulation: many genes that should be switched off in heart muscle cells were active. The researchers examined cells taken from DCM patients with LMNA mutations and found similar abnormalities in gene activity.

A distinctive pattern of gene activity essentially defines what biologists call the identity of a cell. Thus the DCM-causing LMNA mutations had begun to alter the identity of cardiomyocytes, giving them features of other cell types.

The LMNA-mutant cardiomyocytes also had another defect seen in patients with LMNA-linked DCM: the heart muscle cells had lost much of the mechanical elasticity that normally allows them to contract and stretch as needed. The same deficiency was not seen in the LMNA-mutant liver and fat cells.

Research is ongoing to understand whether changes in elasticity in the heart cells with LMNA mutations occurs prior to changes in genome organization, or whether the genome interactions at the lamina help ensure proper elasticity. Their experiments did suggest an explanation for the differences between the lamina-genome connections being badly disrupted in LMNA-mutant cardiomyocytes but not so much in LMNA-mutant liver and fat cells: Every cell type uses a distinct pattern of chemical marks on its genome, called epigenetic marks, to program its patterns of gene activity, and this pattern in cardiomyocytes apparently results in lamina-genome interactions that are especially vulnerable to disruption in the presence of certain LMNA mutations.

The findings reveal the likely importance of the nuclear lamina in regulating cell identity and the physical organization of the genome, Jain said. This also opens up new avenues of research that could one day lead to the successful treatment or prevention of LMNA-mutations and related disorders.

Other co-authors of the study were co-first authors Parisha Shah and Wenjian Lv; and Joshua Rhoades, Andrey Poleshko, Deepti Abbey, Matthew Caporizzo, Ricardo Linares-Saldana, Julie Heffler, Nazish Sayed, Dilip Thomas, Qiaohong Wang, Liam Stanton, Kenneth Bedi, Michael Morley, Thomas Cappola, Anjali Owens, Kenneth Margulies, David Frank, Joseph Wu, Daniel Rader, Wenli Yang, and Benjamin Prosser.

Funding was provided by the Burroughs Wellcome Career Award for Medical Scientists, Gilead Research Scholars Award, Pennsylvania Department of Health, American Heart Association/Allen Initiative, the National Institutes of Health (DP2 HL147123, R35 HL145203, R01 HL149891, F31 HL147416, NSF15-48571, R01 GM137425), the Penn Institute of Regenerative Medicine, and the Winkelman Family Fund for Cardiac Innovation.

###

Penn Medicineis one of the worlds leading academic medical centers, dedicated to the related missions of medical education, biomedical research, and excellence in patient care. Penn Medicine consists of theRaymond and Ruth Perelman School of Medicine at the University of Pennsylvania (founded in 1765 as the nations first medical school) and theUniversity of Pennsylvania Health System, which together form a $8.6 billion enterprise.

The Perelman School of Medicine has been ranked among the top medical schools in the United States for more than 20 years, according toU.S. News & World Report's survey of research-oriented medical schools. The School is consistently among the nation's top recipients of funding from the National Institutes of Health, with $494 million awarded in the 2019 fiscal year.

The University of Pennsylvania Health Systems patient care facilities include: the Hospital of the University of Pennsylvania and Penn Presbyterian Medical Centerwhich are recognized as one of the nations top Honor Roll hospitals byU.S. News & World ReportChester County Hospital; Lancaster General Health; Penn Medicine Princeton Health; and Pennsylvania Hospital, the nations first hospital, founded in 1751. Additional facilities and enterprises include Good Shepherd Penn Partners, Penn Medicine at Home, Lancaster Behavioral Health Hospital, and Princeton House Behavioral Health, among others.

Penn Medicine is powered by a talented and dedicated workforce of more than 43,900 people. The organization also has alliances with top community health systems across both Southeastern Pennsylvania and Southern New Jersey, creating more options for patients no matter where they live.

Penn Medicine is committed to improving lives and health through a variety of community-based programs and activities. In fiscal year 2019, Penn Medicine provided more than $583 million to benefit our community.

See the original post here:
Stem Cell Study Illuminates the Cause of a Devastating Inherited Heart Disorder - Newswise

NEW YORK, Jan. 28, 2021 (GLOBE NEWSWIRE) -- Mesoblast Limited (Nasdaq:MESO; ASX:MSB), global leader in allogeneic cellular medicines for inflammatory diseases, today provided an update on its pipeline of late-stage product candidates, and an activity report for the second quarter ended December 31, 2020.

View post:
Mesoblast Operational and Financial Highlights for Quarter Ended December 31, 2020

Mark Allen, CEO of Elevian, pictured above. Photo courtesy of Elevian.

Once the domain of mythical fountains of youth and movies like The Curious Case of Benjamin Button, the science of aging prevention and reversal is beginning to enter the mainstream with reputable academic institutions launching companies to accomplish this once improbable feat.

One such company, Elevian, founded by a team of Harvard scientists and physician-turned entrepreneurDr. Mark Allen, is working to restore regenerative capacity with the aim of preventing and treating age-related diseases. A critical factor, they say, is a single protein called Growth differentiation factor 11 (GDF11).

Allen, Elevians chief executive officer, first became interested in the science of aging after taking a course focused on exponential thinking.

All of a sudden, problems that were heretofore unsolvable become solvable, Allen said of the theory that is the opposite of incremental and encourages one to think outside of the box. They talked about examples of problems that weve always thought to be unsolvable, one of them being aging and longevity. So that was it for me. I was like thats perfect for me. Thats what I want to work on.

Searching for clues into the diseases associated with aging, Elevians founders, including Harvard professor of Stem Cell and Regenerative BiologyDr. Amy Wagers, mined the proteome, looking into how proteins change with age. They uncovered several, including one with potentially groundbreaking regenerative capabilities, GDF11.

Elevian believes that this single protein, a key player in the circulatory system, could be a game-changer in regenerative medicine.

GDF11 is one of those proteins that change with age, Allen said. They [the founders] really dug into GDF11 because so little was known about it at the time of their discoveries. They did side-by-side studies with the parabiosis model, injecting just GDF11, to see if it could reproduce some of the effects of parabiosis in the aged animal. And they found, much to everybodys surprise, that replenishing just this one circulating factor was able to reproduce the beneficial effects of parabiosis.

Parabiosis, which means living beside, is performed by joining two living organisms surgically to develop a single, shared physiology. It has been used to study conjoined twins, and more recently, in a 1972 lifespan study attaching old and young rats, scientists Frederic C. Ludwig and Robert M. Elashoff showed evidence of an extended lifespan for the older animals.

As a post-doc at Harvard, Dr. Wagers expanded upon this research using modern histology techniques. When Wagers and her colleagues attached the circulatory systems of young mice to old ones, they found strong evidence of a biological reversal of cardiac hypertrophy, which occurs with aging. They attributed this to GDF11 in a paper published in Science in 2014 and recognized as a runner-up to the publications Breakthrough of the Year.

What they found is that the old animals exposed to young blood experienced a biological reversal of aging by many different measures. Their brains grow younger, their hearts grow younger, their lungs, their bones all over their body. And interestingly, the young animals exposed to old blood have accelerated aging. So this is just really strong proof that circulating factors regulate aging, said Allen.

The mechanism of action appears to be that GDF11 binds directly to the endothelial projectors, the cells that line our blood vessels and improve both the quality and quantity of the vasculature. It does not cross the blood-brain barrier, so we think its mechanism is primarily by improving vasculature, he explained.

Elevian, the recent beneficiary of an initial round of seed financing, is actioning this potent protein to develop a potential regenerative treatment for stroke patients.

English biomedical gerontologist Aubrey de Grey, whom Allen credits with doing a lot to start the medical field of aging reversal, outlined several hallmarks of aging in his 2007 book, Ending Aging. These include stem cell exhaustion, protein aggregate buildup, failed intercellular communicationand senescent cells.

One of the barriers to developing therapeutics based on these factors is the inherent incongruence with the usual regulatory approval systems. Following customary protocol, proving that a drug prevents aging or age-related diseases would quite literally take a lifetime.

Theres no regulatory path for treating aging. Even doing a prevention trial would take years and years and years, because you have to take people and wait until they get disease to see effects. So instead, to get a drug to market, we take the opposite extreme. We look at what is the most devastating possible disease, unmet need, where we could treat for the shortest possible duration and see clinically meaningful effects, Allen explained.

Elevian decided on stroke, which is the number two cause of death worldwide and the third leading cause of disability.

The only existing treatments for a stroke are limited to the acute phase, where an IV injection of a drug such as recombinant tissue plasminogen activator (tPA) (Activase)restores blood flow by dissolving the clot causing the event.

In an ischemic stroke, which makes up 87% of cases, a blood clot forms and prevents blood and oxygen from reaching an area of the brain, impacting breathing and heart function and often leading to paralysis. This is where Elevian believes a drug utilizing GDF11, which acts on the circulatory system, holds such promise for rehabilitation.

Allen revealed that his team has already demonstrated GDF11s impact on stroke-stricken animals.

When we give GDF11 to animals that have had strokes and are paralyzed or have severe motor function debilitation, it returns them almost to normal function. It significantly improves motor function recovery, he said.

On the strength of these preclinical results, Elevian is gearing up to enter human clinical trials with GDF11 for the treatment of stroke.

We really got the green light to go into humans based upon the animal data that we got there, Allen said, adding that there is still a lot of work to be done before they reach this phase. We still have to scale up production of the drug and we have to do extensive safety and toxicology tests IND-enabling studies. The longest pole in the tent is figuring out how to make manufacturing costs effective. The cost of goods is going to be really, really high. So were doing a lot of work in process development right now, and then were going to hand it off to a manufacturing partner to scale up. Were about two years from initiating our human clinical trial in stroke.

Another unmet need where Elevian believes GDF11 can have an impact is Type 2 diabetes, a disorder whose pathology is also intricately connected to the circulatory system and often to aging.

Along with blood clotting factors, glucose resides within the inside lining of blood vessels. In Type 2 diabetics, the lining of an individuals blood vessels begins to become glycosylated, which causes them to narrow, impeding blood flow. Glucose tolerance is known to decrease with age.

In a study published in March 2020, Wagers and her colleagues stated that GDF11 was shown to significantly improve glucose tolerance in aged mice and increase glucose homeostasis, under a variety of dietary conditions.

Allen believes that addressing the aging process is the ultimate exponential strategy to solving a whole host of humanitys biggest killers:

This idea that we could, by targeting the aging progress, potentially promote healthy aging, promote a healthy longevity, and reduce the burden of age-related diseases, and that the same treatment could be used to treat and prevent multiple age-related diseases. That concept was like, why arent we working on that? Why are we spending billions of dollars on Alzheimers and billions of dollars on cancer, billions of dollars on heart disease? We could instead target the aging process and potentially treat them all.

Most Read Today

Read the rest here:
Elevian Targets Aging to Solve Humanity's Toughest Diseases - BioSpace

NEW YORK, Jan. 28, 2021 /PRNewswire/ --BrainStorm-Cell Therapeutics Inc. (NASDAQ: BCLI), a leader in developing innovative autologous cellular therapies for highly debilitating neurodegenerative diseases, announced today that the Company will hold a conference call to update shareholders on financial results for the fourth quarter and year ended December 31, 2020, and provide a corporate update, at 8:00 a.m., Eastern Time, on Thursday, February 4, 2020.

BrainStorm's CEO, Chaim Lebovits, will present a corporate update, after which, participant questions will be answered. Joining Mr. Lebovits to answer investment community questions will be Ralph Kern, MD, MHSc, President and Chief Medical Officer, Stacy Lindborg, PhD, Executive Vice President and Global Head of Clinical Research ,David Setboun, PharmD, MBA, Executive Vice President and Chief Operating Officer, Preetam Shah, PhD, MBA, Executive Vice President and Chief Financial Officer.

Participants are encouraged to submit their questions prior to the call by sending them to: q@brainstorm-cell.com. Questions should be submitted by 5:00 p.m. EDT, Wednesday, February 3, 2020.

The investment community may participate in the conference call by dialing the following numbers:

Participant Numbers:

Toll Free: 877-407-9205

International: 201-689-8054

Webcast URL: https://cutt.ly/vjBvkTp

Those interested in listening to the conference call live via the internet may do so by visiting the "Investors & Media" page of BrainStorm's website at http://www.ir.brainstorm-cell.com and clicking on the conference call link.

Those that wish to listen to the replay of the conference call can do so by dialing the numbers below. The replay will be available for 14 days.

Replay Number:

Toll Free: 877-481-4010

International: 919-882-2331

Replay Passcode: 39495

About NurOwn

The NurOwn technology platform (autologous MSC-NTF cells) represents a promising investigational therapeutic approach to targeting disease pathways important in neurodegenerative disorders. MSC-NTF cells are produced from autologous, bone marrow-derived mesenchymal stem cells (MSCs) that have been expanded and differentiated ex vivo. MSCs are converted into MSC-NTF cells by growing them under patented conditions that induce the cells to secrete high levels of neurotrophic factors (NTFs). Autologous MSC-NTF cells can effectively deliver multiple NTFs and immunomodulatory cytokines directly to the site of damage to elicit a desired biological effect and ultimately slow or stabilize disease progression.

Story continues

About BrainStorm Cell Therapeutics Inc.

BrainStorm Cell Therapeutics Inc. is a leading developer of innovative autologous adult stem cell therapeutics for debilitating neurodegenerative diseases. The Company holds the rights to clinical development and commercialization of the NurOwn technology platform used to produce autologous MSC-NTF cells through an exclusive, worldwide licensing agreement. Autologous MSC-NTF cells have received Orphan Drug status designation from the U.S. Food and Drug Administration (FDA) and the European Medicines Agency (EMA) for the treatment of amyotrophic lateral sclerosis (ALS). BrainStorm has completed a phase 3 pivotal trial in ALS (NCT03280056); this trial investigated the safety and efficacy of repeat-administration of autologous MSC-NTF cells and was supported by a grant from the California Institute for Regenerative Medicine (CIRM CLIN2-0989). BrainStorm is in active discussions with the FDA to identify regulatory pathways that may support NurOwn's approval in ALS. BrainStorm is also conducting an FDA-approved phase 2 open-label multicenter trial in progressive multiple sclerosis (MS). The phase 2 study of autologous MSC-NTF cells in patients with progressive MS (NCT03799718) completed dosing in December 2020, and topline results are expected by the end of the first quarter 2021.

For more information, visit the company's website at http://www.brainstorm-cell.com.

ContactsInvestor Relations:Corey Davis, Ph.D.LifeSci Advisors, LLCPhone: +1 646-465-1138cdavis@lifesciadvisors.com

Media:Paul TyahlaSmithSolvePhone: + 1.973.713.3768Paul.tyahla@smithsolve.com

View original content:http://www.prnewswire.com/news-releases/brainstorm-cell-therapeutics-to-announce-fourth-quarter-and-fiscal-year-2020-financial-results-and-provide-a-corporate-update-301217243.html

SOURCE Brainstorm Cell Therapeutics Inc

Continued here:
BrainStorm-Cell Therapeutics to Announce Fourth Quarter and Fiscal Year 2020 Financial Results and Provide a Corporate Update - Yahoo Finance

CENTENNIAL, Colo., Jan. 26, 2021 /PRNewswire/ --Essent Biologics, a nonprofit biotechnology company emerging from two years of stealth-mode operation, today announced its launch as a new venture to meet the growing need for human-derived biomaterials and data to the regenerative medicine research community, as well as producing key inputs for further manufacturing by clinical partners.

As a new venture from AlloSource, one of the world's leading manufacturers of fresh cartilage tissue used for joint repair and skin allografts to heal severe burns, Essent Biologics will leverage its connection to human tissue donation by providing low passaged primary cell lines, origin tissue and comprehensive donor data to advance translational research from benchtop to bedside. The company also has the capability to serve as a biomanufacturing partner, creating a large inventory of custom products.

"We are proud to set a new standard in human-derived biomaterials for research," said Corey Stone, Executive Director, Essent Biologics. "Essent will motivate and empower the work researchers are doing by supporting the development of innovative therapies through quality biomaterials and powerful data."

Essent Biologics will supply highly characterized human mesenchymal stem cells (MSCs) produced under current Good Manufacturing Practices (cGMP). The company has already partnered with leading academic research and biopharmaceutical companies who excitedly await Essent Biologics' official product launch, anticipated in April.For additional information on the company's product pipeline, please visit essentbiologics.org.

"The work Essent is doing to help accelerate research through human clinical trials is remarkable," said Ethan Mann, CEO of Validus Cellular Therapeutics, Inc. "We are excited to partner with such an innovative company who will support research to develop new medical solutions, and we look forward to their future growth."

According to Allied Market Research, the Cellular Therapy and Tissue Engineering industries are some of the fastest growing in the regenerative medicine sector. The Cellular Therapy market tallied a total expenditure of $7.25 billion in 2019 and is expected to hit $48.11 billion by 2027. The Tissue Engineering market tallied a total expenditure of $2.3 billion in 2019 and is expected to hit $6.8 billion by 2027. These strong growth rates are powered by an increase in clinical trials and manufacturing throughput.

About Essent BiologicsEssent Biologics is setting a new standard in human-derived biomaterials and 3D biology data for research. The nonprofit biotechnology company provides low passaged primary cells, origin tissue and scaffolds, as well as comprehensive donor and product data to advance regenerative medicine research from benchtop to bedside. Essent Biologics supplies products in small or large volumes and serves as a manufacturing partner by creating master cell banks and an inventory of custom products within a tailored specification. In order to ensure reliable product quality, safety and efficacy, all Essent Biologics products are developed using robust design control processes and produced under current Good Manufacturing Practices (cGMP). For more information, please visit essentbiologics.org.

Media ContactCorey StoneEssent Biologics720.873.4781cstone@essentbiologics.org

Go here to read the rest:
Essent Biologics Launches With A Mission To Provide Human-Derived Biomaterials And 3D Biology Data For Cell Therapy And Tissue Engineering - The Grand...

The single-use device market is primed for growth. Single-use systems (SUS) are now used for about 85 percent of precommercial scale (preclinical and clinical) biopharmaceutical manufacturing and increasingly for commercial products manufacturing. This shift from fixed stainless steel appears to be revolutionizing the therapeutics market.

While large-scale, fixed stainless-steel equipment-based bioprocessing facilities continue producing biopharmaceuticals, the market for SUS, composed primarily of plastic components that are sealed and sterilized using gamma irradiation, continues its rapid ascent. Medical device makers are seeing growth in single-use instruments and disposable medical devices, including process containers, tubing, connectors, baskets, and valves. According to Grand View Research, in 2019, the global SUS market was valued at $12.6 billion, with a 12.8 percent compound annual growth rate forecast through 2027, when it will top $33 billion.

Lower energy and direct-labor costs plus faster changeover times are important reasons why. Like any major change, the SUS shift brings with it challenges as pharmaceutical manufacturers and medical device makers turn to their suppliers to provide assurance that their products deploy operational best practices and are certifiably safe.

To address key challenges in the SUS market and meet the product development needs of Tier 1 pharmaceutical and medical device companies, collaboration is seen between Tier 2 system suppliers and Tier 3 components suppliers.

One such effort comes in the form of the BioPhorum Operations Group, a global collaboration comprising more than 90 Tier 1, 2 and 3 biopharmaceutical companies and suppliers; its purpose is to develop and share best practices for pharmaceutical and medical device manufacturing. For example, BioPhorum has succeeded in establishing effective testing methods for extractables and leachables to help the industry approve SUS for safe and effective use.

To select processing materials that avoid risk, its important to understand the chemical nature of extractables, which are compounds emitted from a packaging component, delivery system, or manufacturing surface during aggressive testing; and leachables, which are compounds that migrate into the drug over time from contact with the system componentry and manufacturing surfaces.

To assist suppliers with their evaluation of SUS extractables, the BioPhorum team developed testing protocols based on a set of solvents and immersion times. Adhering to such protocols helps ensure the successful use of SUS for biopharmaceutical manufacturing, though the final responsibility for confirming the safety and efficacy of the therapeutic remains that of the Tier 1 pharmaceutical companies and medical device makers, not their suppliers.

Complementing the BioPhorum extractables protocol is a best practice guide for evaluating SUS leachables. BioPhorum protocol applies to SUS components that contact the pharmaceutical product or process fluids, including but not limited to the medical device/drug delivery market:

Note: The standardized extractables testing protocol does not cover final container closure systems.

Achieving medical-grade system components requires treating the part as a medical product when it comes to cleanroom and manufacturing practices. For tubing, for example, its no longer acceptable to manufacture medical-device-grade tubing on the production floor and then attempt to sterilize it. Tubing production for any medical device must take place in ISO certified cleanrooms that adhere to FDA's Current Good Manufacturing Practices governing particulates, air pressure, and personnel practices to ensure that products meet tolerance and cleanliness requirements. This may require bioburden and endotoxin testing.

These procedures help ensure production of safe, validated products in critical areas such as the transfer of monoclonal antibodies, laboratory-produced base media for therapeutics engineered to represent the bodys immunes system and used in the development of cancer-treating therapeutics. The tubing must be bacteria-free and remain strong as it transfers the monoclonal antibodies to the bioreactor and chromatography equipment, where wanted therapeutics are filtered out.

Other single-use tubing applications include peristaltic pumps with rotating wheels that push the fluid through tubes. To withstand the rigors of the pumping process and ensure that the tubing walls remain intact, high-strength tubing is required.

Advancements in therapeutics will continue driving the development and growth of SUS and their components. One such advancementchimeric antigen receptor (CAR T) cell therapy under development by Kite, a Gilead Companytaps into the potential of personalized medicine for cancer treatments, using the patients immune system to target and attack tumors.

T-cells, a white blood cell developed from stem cells in the bone marrow, help the body to fight cancer and infections. Currently, three FDA-approved CAR T cell therapies, developed by Gilead and Novartis, are available. There is also exponential growth of other biotechnology and pharmaceutical companies actively advancing cellular immunotherapies through clinical trials.

Investigational for now, the safety and efficacy of T-cell therapy is an active area of research, and it could prove to be a game-changer. A cancer patients blood is collected and purified to select the T-cells, which are activated and expanded within the lab and transfected to express a chimeric antigen receptor, or synthetic T-cell receptor, targeting a specific tumor antigen. The T-cells grow and expand for two weeks and are then infused back into the patient where the engineered cells attack the tumors. This chain of events requires a precise timeline with all components of the process being sterile and having passed stringent testing for quality and reliability.

Unlocking the immune system to effectively fight cancer is truly exciting and serves as a great illustration of the potential medical device use of SUS in biopharmaceutical processing.

Continue reading here:
Onward and Upward for Single-Use Systems in Bioprocessing - Medical Device and Diagnostics Industry

Regenerative Medicine Market Major Players:

Players active in the global regenerative medicine market include Osiris Therapeutics, Cook Biotech, Organogenesis, Baxter International, Inc., Stryker and RTI surgical, LifeSciences, CryoLife, Advanced Cell Technology, Sanofi, BioMimetic Therapeutics, Medtronic, StemCellsInc, and LifeCell Kinetic Concepts, among others.

ALSO READ :https://sapanas.tumblr.com/post/631130245458739200/regenerative-medicine-market-competitive-analysis

Regenerative Medicine Market Outlook

Global regenerative medicine market is growing continually, witnessing a massive uptake. Market growth primarily attributes to the increasing advancement in healthcare technology and the growing prevalence of chronic diseases. Besides, improvements in the field of regenerative medicine and stem cell technology drive the growth of the market excellently.

Moreover, the rising uptake of therapeutics such as stem cell biology, cellular therapy, tissue engineering in applications, including cord blood, oncology, urology, orthopedics, neurology, dermatology, and others accelerate the market growth. According to Market Research Future (MRFR), the global regenerative medicine market is poised to grow at 25.4% CAGR throughout the forecast period (2016 2022).

ALSO READ :https://yarabook.com/read-blog/138540

Additionally, the rising uptake of stem cell & tissue engineering processes in the treatment of health issues ranging from orthopedics, musculoskeletal & spine, dental, and skin/integumentary to cancer, neurology, and cardiology substantiate the market growth. Furthermore, the increasing rate of road accidents, injuries, and trauma cases drive the market exponentially, driving the demand for transplants & surgical reconstruction procedures.

On the other hand, factors such as the lack of awareness, skilled professionals, and stringent regulatory policies are projected to act as significant impeders for market growth. Nevertheless, funding support for the development of regenerative medicines would support the growth of the market throughout the predicted period. Also, widening application areas of regenerative medicines in the field of stem cell reconstructive and skin grafting would increase the market growth.

Global Regenerative Medicine Market Segments

The analysis is segmented into four dynamics;

By Material: Synthetic Materials, Genetically Engineered Materials, Pharmaceuticals, and others.

By Therapy: Stem Cell Biology, Cellular Therapy, Tissue Engineering, and others.

By Application: Cord Blood, Oncology, Urology, Orthopedics, Neurology, Dermatology, and others.

ALSO READ :http://www.marketwatch.com/press-release/fram-market-2021-industrytrends-opportunities-market-volume-competitive-landscape-possible-challenges-and-forecast-to-2025-2021-01-06

By Regions: Americas, Europe, Asia Pacific, Middle East & Africa, and Rest-of-the-World.

Regenerative Medicine Market Regional Analysis

North America is projected to continue dominating the globalregenerative medicine marketthroughout the forecast period. In 2015, North America accounted for more than 44% of the overall market share. This huge market growth attributes to the presence of a large number of major players and pharma & biotechnology companies. Moreover, huge investments made by public & private organizations drive the regenerative medicine industry in the region.

Besides, the rising prevalence of chronic diseases and orthopedic issues and increasing clinical trials to evaluate the therapeutic potential of products foster regional market growth. Also, the well-spread awareness towards the therapeutic potency of regenerative medicines impacts the market growth positively. The North American regenerative medicine market is expected to grow at a robust CAGR of 22.3% over the review period.

Europe stands second in the global regenerative medicine market. Factors such as the increasing per capita healthcare expenses and penetration of healthcare sectors in the region boost the market growth. Additionally, the rising government support and R&D funding in the life science developments substantiate the regional market growth. Markets in the UK, Germany, and France, contribute to the regional market majorly. The European regenerative medicine market is estimated to grow at 22.5% CAGR during the assessment period.

ALSO READ :http://www.marketwatch.com/press-release/m2m-communication-market-demand-to-rise-amid-industrial-automation-industry-analysis-with-business-trends-covid19-outbreak-competitor-strategyforecast-to-2023-2021-01-05

The Asia Pacific regenerative medicine market has emerged as a rapidly growing market. Factors such as the large advances in biotechnology and increasing government support for R&D are fostering the growth of the regional market. Regenerative medicine markets in highly populated countries such as China, India, and Japan support the regional market growth excellently, heading with huge technological advances. The APAC Regenerative Medicine market is predicted to demonstrate huge growth potential.

Global Regenerative Medicine Market Competitive Analysis

The well-established regenerative medicine market appears to be highly competitive with the presence of several notable players. To gain a larger competitive advantage, market players incorporate strategic initiatives such as mergers & acquisitions, expansions, and product/technology launch. Also, they make substantial investments to drive R&D to develop their capabilities and to expand their global footprints. Simultaneously, R&D funding programs initiated by the governments to enhance regenerative medicine capabilities are offering high growth potential. This is further going to attract several new entrants to the market and intensify the market competition further.

Regenerative Medicine Industry/Innovations/Related News:

March 15, 2020 - Research team at the University of Sheffield published their study on stem cell mutations that could improve regenerative medicine in the magazine Stem Cell Reports. Their study gives new insights into the cause of mutations in pluripotent stem cells and potential ways of stopping these mutations from occurring. It also suggests ways to reduce the likelihood of variations occurring in these cells when cultured. There is considerable interest in using Pluripotent stem cells to produce cells that can replace diseased or damaged tissues in applications referred to as regenerative medicine.

ALSO READ :http://www.marketwatch.com/press-release/waste-to-energy-market-share-size-key-players-regional-study-and-forecast-2024-2020-12-30

https://neighborwebsj.com/

Read this article:
Global Regenerative Medicine Market Insights, Overview, Analysis and Forecast 2022 NeighborWebSJ - NeighborWebSJ

Mesoblast, MESO, is an Australian based biopharmaceutical company that has been a market favorite, even though the companys ups and downs have confused many investors.

The MESO share price has been inconsistent lately. This has prompted many investors to ask why. Analyzed carefully, MESO has done better than many stem cell businesses. Most stem cell businesses fail to ever make a profit and fail to even get a product to market. This can cause long-term problems with the stock price of any company.

ByMichael A. Mannen, MS

Mesoblast as a company is committed to offering groundbreaking cellular therapies for the treatment of many severe diseases using Mesenchymal Stem Cells. They are dedicated to cellular medicines and leveraging their stem cell technology. There are not many successful companies in this niche.

Adult stem cells are undifferentiated cells that divide and rebuild the damaged tissue. Mesenchymal Stem Cells are a type of adult stem cells generated from some of the adult tissues present in the body.

Stem cells have been found by scientists to have two properties: self-renewal and the potential to divide into specialized cell types. Multi-potent, mesenchymal stem cells are found to be present in many adult tissues. The bone marrow is considered by many scientists to be the most usable reservoir of adult human stem cells.

For several disorders, such as heart failure, the capacity to rebuild tissue may be groundbreaking for treatment. And this has been the inspiration for many companies exploring stem cell therapies.

However, what differentiates Mesoblast from other stem cell companies is its approach to treating inflammatory diseases. Their products have the potential to make breakthroughs a reality for many diseases.

The company has developed and manufactured its own patented mesenchymal lineage cells to be used for a range of ailments. These have a potential for the regeneration of tissues. These cells, however, secrete a number of biomolecules which can help the body heal more than just tissue damage. They may be important to supporting immune responses needed for recovery in many diseases.

Possible rejection of the patients immune system is the biggest problem with the use of stem cell therapies in heart diseases and other diseases. This can worsen many illnesses.

MESO does appear committed to the quality of its product. For MESO it is a question of the effectiveness and safety of their products. Its a long and winding road to provide adequate scientific proof when presenting breakthrough treatments to regulators. Many less reputable organizations have touted stem cells without doing the necessary scientific investigation or seeking the necessary regulatory approval. Mesoblast is trying to do things the right way. Committing to doing science the right way leads to a lot of inevitable ups and downs. This raises financial speculation and can lead to wild fluctuations in the stock price of any company.

A further significant advantage of some of Mesoblasts products is that they apparently can be administered to patients without needing donor matching. This increases their viability. Moreover, it allows for a wide spectrum of patients to be treated from their products. This gives them an advantage in comparison with other firms and should potentially allow them to increasingly gain a larger market share.

Of great interest to investors include the many clinical trial phase 3 products that Mesoblast has in its pipeline. These include MPC-06-ID, Remestemcel-L, and REVASCOR.

Remestemcel-L is a Mesoblast therapy that may theoretically have properties to help with the treatment of ventilator-dependent patients with COVID-19 patients. However, a clinical trial reported some concerns with the therapy meeting its primary endpoint. And it sent the stock down in December 2020. Obviously, there is a large demand for the treatment of complications linked to Covid-19, so this bad news disappointed investors.

However, another therapy has shown promise in the DREAM-HF Phase 3 for patients with chronic heart failure. Although the Revasacor did not stop heart failure, it did seem to deliver dramatic reductions in heart attacks and other negative cardiovascular events that plague heart failure patients.

Heart failure is a pathology that involves ones heart having trouble pumping. The condition impacts millions of people worldwide. In order to feed and maintain it working, the heart muscle depends on a continuous supply of oxygen rich blood. Having stem cell therapies is highly desirable to treat cardiovascular diseases. Hopefully, many Cardiovascular disorders can be treated with stem cell therapies in the future.

Other conditions such as hypertension and Coronary artery disease can help lead to heart failure. According to the Mayo Clinic, heart failure can cause significant health complications and lead to Liver and Kidney damage in patients.

Some scientists believe that Mesenchymal Stem Cells when used to treat cardiovascular diseases can preserve the myocardium by reducing the intensity of inflammation and supporting angiogenesis. Angiogenesis is a mechanism used by the body to create new blood vessels. Their low immunogenicity once more makes them a perfect treatment. This helps ensure that the immune system of the patient does not produce a negative response to the therapy. This theoretically can give stem cell therapies an advantage over some protein-based treatments that are easily recognized by the patients immune system.

This product could be a major development for Mesoblast moving forward, although further analysis and testing is still needed.

Stem cell therapies are not without experimental and medical challenges. For example, there are concerns with the ability of stem cell migration to tissues that require regeneration. There may also be cases whereby stem cells are divided into unintended cells. There may also be difficulties with the manufacturing and culturing of stem cells. Identification of Mesenchymal stem cells in cell populations can be problematic. From a scientific point of view, bone marrow derived Mesenchymal Stem Cells are known to be the best source for obtaining these cells in the human body.

Mesoblast has a wide range of advanced research programs related to different stem cell therapies. MPC-06-ID could potentially be a viable therapy for treating chronic low back pain attributable to degenerative disc disease.

These are products that consumers should be thrilled about.

The company has solid financials for a stem cell company and has a lot of cash on hand. The stock had a market cap of over 2 billion on 9/30/2020 and a 52-week high of 21.28. Lately the news surrounding the companys clinical trials has been a potpourri of both good and bad, so the share price has settled at around $9. It has a float of 93.7 million shares.

Mesoblast is a really exciting healthcare business. The business has made a commitment for the future. And it should be a stock that investors continue to follow.

Link:
Mesoblast Limited: Is Stemcell Therapy Ready For Prime Time? - Sick Economics

Introduction

Chronic myeloid leukemia (CML) is a hematological malignancy that develops when the 9;22 translocation in a single hematopoietic stem cell (HSC) results in the expression of BCR-ABL1 tyrosine kinase fusion protein. If left untreated, CML progresses over approximately 5 years, from relatively benign chronic phase to accelerated phase, and then to fatal blast crisis. The introduction of tyrosine kinase inhibitors (TKIs) specifically targeting the BCR-ABL1 fusion protein was a breakthrough in the management of CML, leading to a significant reduction in mortality and improved 5-year survival rates. However, despite the high annual acquisition costs of all the TKIs; first-, second-, and-third line TKIs1 induce only transient responses in the 10% to 15% of CML patients diagnosed in advanced phase, suboptimal responses in approximately 30% of CML patients during chronic phase (CP) cases that experience disease progression each year during, and only 1020% chance of successful treatment discontinuation due to disease persistence.2 Among the causes of disease persistence, studies have shown that CML leukemia stem cells (LSC) play a major role in inducing therapeutic resistance and disease progression because they are able to self-renew.3,4 These LSC a rare subset of immature cells residing in the bone marrow niche are protected from the action of TKI5 because these cells are normally quiescent and the TKIs are designed to target malignant blast cells that proliferate. That is why current strategies are not able to effectively eliminate the LSC or the disease.3 In CML, LSC are primitive cells expressing CD34+ CD38- with the 9;22 translocations, or the Philadelphia chromosome (Ph).6 However, these markers cannot distinguish the cancer hematopoietic cells from normal ones. Additionally, the BCR-ABL fusion gene encodes for an intracellular tyrosine kinase protein rather than a surface protein, calling for the need to identify unique surface biomarkers for efficient targeting of this cell population with subsequent eradication of the root of the disease.

In 2010, a single biomarker, Interleukin 1 receptor accessory protein (IL1RAP), was found to be up-regulated on the cell surface of BCR-ABL+ LSC. They were able to distinguish Ph+ from Ph- LSCs using IL1RAP.7 A polyclonal anti-human IL1RAP was generated that not only targeted the LSC population but also killed normal peripheral blood mononuclear cells, indicating that this marker was not specific to the LSC.7 Another characteristic cell surface marker has been investigated; ThomsenFriedenreich antigen (TF, or CD176) a tumor-associated carbohydrate epitope. The CD176 antigen was found to be expressed on the surface of various cancer-initiating cells, such as breast carcinomas,8 colorectal carcinomas,9 several leukemias,10 and other types of cancer, but was absent from almost all normal adult cell types.11 CD176 was also found to be expressed on the surface of CD34+ hematopoietic stem cells of the K562 erythroblastic leukemia cell line; a cell line derived from a CML patient. Being strongly expressed on the surface of cancer cells and virtually absent from normal tissues, CD176 was evaluated as a suitable target for cancer biotherapy8 with the development of an anti-CD176 antibody that induced apoptosis of leukemic cells.12

Using monoclonal antibodies (mAb) as a tool for cancer therapy still has its limitations. Patients who receive mAb therapy may develop drug resistance or fail to respond to treatment owing to the multiple signaling pathways involved in the pathogenesis of cancer and other diseases.13 Targeting more than one molecule has proven to circumvent the regulation of parallel pathways and avoid resistance to the treatment.14 Bi-specific antibodies (Bis-Ab) are antibodies that can recognize two different epitopes. They can redirect specific immune cells to the tumor cells to enhance tumor eradication, enable the simultaneous blocking of two different targets that have common signaling pathways, or interact with two different cell-surface antigens instead of one with subsequent boosting of the binding specificity.13 Thus, the identification of two surface markers specific to the cancer stem cells would be useful in characterizing and targeting CML stem cells, without affecting other blood cells.

In this study, we evaluated co-expression of IL1RAP, linked to BCR-ABL+ expression, and the CD176 antigen, carried on the hematopoietic stem cell marker CD34 molecule, in CML patients. We identified PBMCs co-expressing CD34, IL1RAP, and CD176 antigens using flow cytometry, a finding that allowed for subsequent separation and targeting of such cells from normal HSCs. A bi-specific antibody (TF/RAP), was generated in order to target the IL1RAP+ and CD176+ cell population among PBMCs in patients with CML. We used a flow-cytometry assay as a cell-based assay to measure the antibody binding capability of the TF/RAP Bis-Ab to the cell surface antigens. Our TF/RAP Bis-Ab, increased targeting of the IL1RAP+ and CD176+ cell population among CML PBMCs but not corresponding normal cells, using complement-dependent cytotoxicity assay (CDC). This novel TF/RAP Bis-Ab may provide a novel strategy for the eradication of CML stem cells.

Deidentified samples of peripheral blood from healthy volunteers were obtained from Gulf Coast Regional Blood Bank (Houston, TX, USA) after signing informed consent and used as reference samples. Deidentified samples of peripheral blood mononuclear cells (PBMCs) from consented patients with CML were obtained from Oncology Research Gundersen BioBank (https://www.gundersenhealth.org/research/biobank/, La Crosse, WI, USA). While the samples were de-identified, necessary CML patient characteristics were collected (Table 1). The collection and dissemination protocols for the samples are approved by The Gundersen Human Subjects Committee/Institutional Review Board (IRB) and are in full compliance with National Cancer Institute Best Practices for Biospecimen Resources. Because the de-identified samples were received through Biobanks and not through direct intervention/interaction with a research subject, the Tulane University Human Research Protection Office was notified and this study was classified by the IRB as exempt as the study did not meet the definition of human subjects research according to US Federal policy (HHS regulations, 45 CFR part 46, subpart A, also known as the Common Rule). The study was conducted in accordance with the Declaration of Helsinki.

Table 1 CML Patients Characteristics

HEK 293FT cell line (Invitrogen # R70007) was cultured in DMEM (Life Technologies, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, 100 g/mL streptomycin sulfate, and 4.0 mM L-glutamine (Gibco BRL products, Gaithersburg, MD), at 37C in a humidified 5% CO2 incubator. The KG1 cell line (ATCC #CCL-246) and transduced derivative cells were cultured in Iscoves Modified Dulbeccos Medium (Life technologies) supplemented with 20% FBS at 37C in a humidified 5% CO2 incubator. K562 cell line (ATCC# CCL-243) was maintained in RPMI-1640 (Life technologies) supplemented with 10% FBS, 100 U/mL penicillin, 100 g/mL streptomycin sulfate at 37C in a humidified 5% CO2 incubator.

The IL1RAP cDNA was PCR amplified from an expression plasmid containing Human IL-1RAcP/IL-1R3 Gene ORF cDNA (Sino biological Inc., HG10121-CM) using Clone Amp HiFi PCR Premix (Takara Bio USA, Inc.), and primers that included either a BamHI or an XhoI site (F-IL1RAP: acgggatccccaccaagcttggtaccatgac; R-IL1RAP: acgctcgagttatacatttttcaaagatg). The PCR fragment was gel extracted as above, sub-cloned into BamHI and XhoI sites in the pHRST-MPSV vector according to standard protocols and confirmed by restriction mapping and sequencing.

Transient production of lentiviral particles in adherent HEK293T was modified from previously described.15 Briefly, HEK293T cells were seeded in a T-75 flask, where we used 4.0 g of envelope plasmid pMPSV-VSV-G, 10.0 g packaging plasmid psPAX2, and 26 g transfer plasmid that has the gene of interest. In our case, the transfer plasmid is either the antibody plasmid or the control. The plasmids were mixed into 500 L 0.25 M CaCl2 (Sigma Aldrich, St. Louis, MO) and incubated at room temperature for 5 minutes, and then mixed with 500 L 2xHBS and briefly vortexed. The mixed transfection cocktail was then incubated for 3 minutes at room temperature, and added into the medium of the cells, and mixed gently to make an even distribution. After 16 hours of incubation, the medium was replaced with fresh medium and collected every 24 hours for 3 days. The conditioned medium that contained the vector virus was then pelleted for 10 minutes at 1500 g and passed through a 0.45-m filter to remove the cell debris, and then frozen at 80C for long-term storage, or used for the transduction of target cells.

Lentiviral transduction was done as previously described.1618 In brief, lentiviral supernatant was added to KG1 cells cultured in complete IMEM. After overnight incubation, the lentiviral vector was removed, and fresh media was added. After 48 hours, IL1RAP expression was demonstrated by flow cytometry using anti-Human IL-1 RAcP/IL-1 R3 PE-conjugated antibody (#FAB676P, R&D Systems, Minneapolis, MN).

The CH and CL constant domains in the pLM219 plasmids were amplified with 0.5 nM overlapping mutant primers (Table S1), Deep Vent Polymerase (New England Biolabs), and reaction buffer for forty cycles at 94C for 10 seconds, 60C for 45 seconds, and 72C for 2 minutes. Initial fragments were purified, combined, and used to amplify the entire heavy or light domains (Table S2). The mutated fragments were then gel purified and sub-cloned into their corresponding vectors using restriction enzymes according to standard protocols (Table S2). Sequences were then verified by restriction digestion and sequencing.

For antibody sequences towards CD176 (TF) and IL1RAP, the VH and VL domains from two clones with the most conserved amino acid sequences (TF Clone 1 and Clone 2 called TF1 and TF2 for CD176; Clone 4B6 and Clone 4G9 called RAPa and RAPb for IL1RAP, respectively) were chosen from published sequences.20,21 IL1RAP antibody was designed to target the extracellular membrane anchor-proximal region that comprises an amino acid primary sequence VPAPRYTVELAC within 10 to 15 amino acids of amino acid 361 of human ILR1AP (Gene bank accession Q9NPH3) while the TF antibody was designed to target the same Gal(13)GalNAc disaccharide epitope20 as the Bis-Ab. Variable domains (VD) were codon-optimized and synthesized (Gene Art, Invitrogen) to be compatible with 15 base pairs of homologous sequences on both the 3 and 5 ends of pLM2 recipient plasmid flanking the EcoRI restriction enzyme site.

The pLM2 expression vector was digested with EcoRI to generate a double-stranded break. An In-Fusion HD cloning kit (Clontech, Inc) was used to clone the VD regions of the antibodies between the leader and constant regions of the pLM2 vectors. The correct clones were identified by PCR and restriction mapping and then verified by sequencing.

Adherent HEK cells were transfected as above. A total of 14 g high-quality plasmid-DNA, 10% GFP plasmid for assessment of transfection efficiency, while the rest was heavy and light chain plasmid DNA combined at a ratio of 1:1. Six to 8 hours later, cells were gently washed once with PBS and fresh growth medium added. Sixteen hours post-transfection, the medium was replaced with DMEM supplemented with 5% FCS and incubated at 5% CO2 for 24 hours prior to the initial collection of antibody supernatant. A second collection was made after a further 24 hours.

Flow antibodies used were as follows: anti-TF/CD176 mAb mouse IgM (Glycotope, Berlin, Germany) targeting Gal1-3GalNAc epitope; FITC-conjugated anti-mouse IgM secondary antibody (-chain specific, #F9259; Sigma); PE-conjugated mouse anti-human IL-1 RAcP/IL-1 R3 monoclonal IgG1 antibody, epitope Ser21-Glu359 (#FAB676P, R&D Systems); APC-conjugated mouse anti-human CD34 monoclonal IgG1 antibody (#QBEnd10, FAB7227A-025, R&D Systems); APC-conjugated mouse antihuman IgG monoclonal antibody (Clone G18-145, mouse IgG1 , #550,931, BD Pharmingen).

LIVE/DEAD Fixable Aqua Dead Cell Stain Kit (#L34957, Invitrogen); Vibrio Cholera Neuraminidase (VCN; Sigma Aldrich Inc), an enzyme used to expose the CD176 on the surface of expressing cells. Flow cytometric analyses were performed in a BD LSR Fortessa (BD Biosciences, USA) and flow cytometric cell sorting was done in a FACSAriaII (P0010) cell sorter (BD Biosciences, USA). The amount of bi-specific antibody bound to the receptors was calculated from the frequency of total IgG bound receptors.

Sorted cells were received in RPMI media and then fixed using the standard 3:1 methanol: acetic acid fixative. Standard procedures were used for FISH hybridization and washing.22 The BCR/ABL1 Plus translocation, dual fusion probe set (Cytocell Inc., Tarrytown, NY) was used. Slides were analyzed using Leica Biosystems Cyto Vision. FISH nomenclature was described according to the ISCN 2016.23

CD34+CD176+IL1RAP+ and CD34+CD176+IL1RAP- cells were sorted from PBMC samples derived from patients with CML. Cells (1 x 103) were plated in Metho Cult Express (#04437, Stem Cell Technologies, Vancouver, Canada) semi-solid media containing recombinant human IL-3, IL-6, G-CSF, GM-CSF, SCF, TPO and cultured for 2 weeks in a humidified atmosphere at 37C with 5% CO2. Fourteen days after plating, the number of colonies was counted by microscopy.24,25

The capacity to induce CDC was assessed essentially as has been described.2628 Briefly, target cells (1105 cells) were pre-incubated at 37C for 60 min with diluted antibodies. Human serum from human male AB (Sigma Aldrich) (20% v/v) was added to the cells as a source of complement and incubated at 37C for an additional 45 min. Cells were then put on ice and viability was determined by staining with LIVE/DEAD staining and detected using a FORTESSA flow cytometer (BD Biosciences). CDC activity was expressed as a percentage of lyses as determined from the increase in the percentage of cells stained positive with the LIVE/DEAD marker compared to the control samples. Cycloviolacin O2 (CyO2, 0.05nM), a pore-forming peptide, was used as a positive control because it kills cells with the similar mechanisms as CDC by causing pores in the cell membrane.

The capacity to induce CDC was assessed essentially as has been described.2628 Briefly, target cells (1105 cells) were pre-incubated at 37C for 60 min with diluted antibodies. Human serum from human male AB (Sigma Aldrich) (20% (v/v)) was added to the cells as a source of complement and incubated at 37C for an additional 45 min. Cells were then put on ice and viability was determined by staining with LIVE/DEAD staining and detected using a FORTESSA flow cytometer (BD Biosciences). CDC activity was expressed as a percentage of lyses as determined from the increase in the percentage of cells stained positive with the LIVE/DEAD marker compared to the control samples. Cycloviolacin O2 (CyO2, 0.05nM), a pore-forming peptide, was used as a positive control because it kills cells with the similar mechanisms as CDC by causing pores in the cell membrane.

We measured the production of the Bis-Ab by ELISA. Plates were initially coated with goat anti-Human IgG heavy chain antibody (Axell) and blocked with PBS containing 0.5% Tween 20 (Fisher), 10% FBS (FetalPlex Animal Serum Complex, GeminiBio, Cat#100-602), 4% whey protein (BiPRO, AGROPUR). Undiluted or diluted supernatant was added, including the standard curve samples (human IgG MAb 1.7B, kindly provided by Dr. James Robinson), and negative blocking buffer. After incubating at 37C for 60 min, the plates were washed. Then, goat anti-Human lambda antibody conjugated to HRP (Southern Biotech, Cat# 207005) was added at 1:300 in blocking buffer for 60 min and washed five times. A mixture of 0.1M Na Acetate (pH 6), peroxide, and TMB substrate were added. The reaction was terminated by adding 1M phosphoric acid, and the absorbance of each well was measured at 450 nm using a Synergy H1 microplate reader (BioTek).

For each experiment, more than three independent replicates were conducted, and the results were expressed as average standard deviation. Comparison of multiple groups was conducted using ANOVA-based Test and p< 0.05 (*) represented significances with statistical meaning. Calculation of the Kd was done using the equation % RO = [Ab]/([Ab]+Kd) 100%, where RO is the receptor occupancy, Ab is the concentration of antibody and Kd is the equilibrium dissociation constant.

In order to analyze the co-expression of CD176 and IL1RAP antigens on CD34+ cells, peripheral blood mononuclear cells from a normal volunteer (NPBMCs), patients with CML, and K562 cells were isolated and stained with anti-CD34, anti-CD176, and anti-IL1RAP monoclonal antibodies and analyzed by flow cytometry (Figure 1A). It has been previously established that these markers were not expressed on normal PBMCs nor on stem cells7,10 CD34+ cell expression ranged from an average 938% in CML samples versus 83.7% in K562 cells (Figure 1A, upper panel). Within the CD34+ cell population, CD176 and IL1RAP antigens were variably expressed in CML samples, ranging from 1.35% in CML-4 to over 50% in CML-1 (Figure 1A, lower panel), while CD176+ IL1RAP+ was detected in 78% of CD34 cells in K562 cells. Surprisingly, surface co-expression of CD176 and IL1RAP was not only detectable on CD34+ cells in patients with BCR-ABL positive CML but was also demonstrable in cells from a treated patient who was BCR-ABL negative (CML-2) (Figure 1B). In Figure 1C, CD34+ cells revealed higher frequency of CD176+ IL1RAP+ in CML group compared to control sample (17.5% versus 3.4%, p<0.001).

Figure 1 CD176 and IL1RAP antigens are co-expressed on CD34+ Leukemia stem cells. Peripheral blood mononuclear cells from patients with CML and healthy volunteers were isolated and stained for flow-cytometry analysis. (A) FACS Dot Blot showing expression of CD34 (top row) and co-expression of CD176 and IL1RAP antigens on the CD34+ cells (bottom row) in PBMCs from patients with CML compared to NPBMCs. (B) Bar graphs showing the BCR-ABL status relative to the percentage of IL1RAP and CD176 co-expression in the CD34+ subsets from patients with CML as compared to the normal control and the positive control (K562 cells). The BCR-ABL status is indicated below the sample. The error bars represent the variation in two independent experiments. (C) Average percentage of CD34+ and CD34+ CD176+ IL1RAP+ subsets in normal versus CML patients respectively. (D) Bar graphs showing the average count of colony-forming units (CFU) per 1000 CD34+CD176+IL1RAP- cells (open bar) or CD34+CD176+IL1RAP+ cells (solid bar) obtained from CML-2 and CML-4 samples. **p< 0.01, n.s represents that there is no significant difference between groups.

In order to analyze the progenitor activity of the various subpopulations, CML-2 and CML-4 were flow-sorted for CD34+CD176+IL1RAP+ and CD34+CD176+IL1RAP- then plated in media t support hematopoietic colony formation. The number of colonies, or colony-forming units (CFU), in CD34+CD176+IL1RAP+ pool represented 6% of the sorted cells with a significant difference between both populations, p<0.01 (Figure 1D and Figure S1).

To facilitate correct interaction of the VH and VL domains, site-directed mutagenesis was used to generate knob-in-hole mutations in the heavy and light chains of the constant domains (Figure 2A) via polymerase chain reaction overlap extension (Figures S2 and 3). Two PCR reactions were performed to generate two amplicons with the specific mutations included in the overlapping primers. The two fragments were then combined in a subsequent fusion reaction, in which the overlapping ends anneal, allowing the 3 overlap of each strand to serve as a primer for the 3 extension of the complementary strand. The resulting fusion product served as a template for amplification of the entire constant domain. In order to circumvent the light chain mismatching, an Orthogonal Fab interface was generated. In one Fab, complementary mutation was introduced and verified at the heavy chain constant domain (CH1_H172A_ F174G) and at the light chain constant domain (CL_L135Y_S176W), respectively (Figures S46). For the heavy chain heterodimerization, we used the Knob-in-Hole strategy, where we inserted the CH3 mutations (S354C and T366W) into different heavy chains (Figures S7 and 8). The VH and VL sequences were synthesized and cloned into the new pLM2-CH and -CL plasmids (Figure 2A) where CD176 was represented by TF1 (VH1 and VL1) and TF2 (VH2 and VL2) while IL1RAP was represented by Clone 4B6 (VHa and VLa) and Clone 4G9 (VHb and VLb). Then, we generated the four different bi-specific antibody mixtures (TF1RAPa, TF1RAPb, TF2RAPa, and TF2RAPb) to evaluate the most effective Bis-Ab (Figure 2B). The bispecific antibody was quantified by ELISA at 283 ng/mL. Since ELISA used the human IgG heavy chain antibody as the primary antibody and a goat anti-human lambda antibody conjugated to HRP as the secondary antibody, these data also confirm the correct association of the heavy and light chains and ensure that monomers are excluded.

Figure 2 The bi-specific antibody arms. (A) Schematic diagram of the bi-specific antibody showing the mutant arms and the antigen-binding domains. Thomsen-Freidenrich or CD176 domains (TF); IL1RAP domains (RAP); variable domain-heavy chain (VH); variable domain-light chain (VL); L135Y and S176W mutations (Y-W) in constant domain-light chain; H172A and F174G mutations in CH1 domain (A-G); S354C (C) or T366W (W) mutations in CH3. (B) Antibody mixtures generated by transient transfection of HEK 293T cells. TF1 and TF2 was paired with RAPa and RAPb to generate four Bis-Ab mixtures. The bispecific antibody concentration was 283 ng/mL as measured with ELISA. The correct association of the human IgG heavy chain and the lambda light chain was confirm and monomers were excluded by using anti-IgG primary antibodies and anti-light chain secondary antibodies.

KG1 cell line is an acute myeloid leukemia cell line that is known to be a positive control for CD176. For optimizing the staining protocol of CD176, KG1 cells were pre-treated with VCN to expose CD176 antigens for better staining (Figure S9). In order to test the binding capability and functional potential of our bi-specific antibody, we generated a dual-positive cell line for expressing both IL1RAP and CD176 through lentiviral transduction (Figure S10A and B). IL1RAP expression was increased by 1.5 folds in KG1/RAP cells as verified by flow cytometry (Figure S10C and D).

CD176 antigen is a glycosylated antigen; a protein antigen bound to GAL-NAC moiety which makes the antigen displayed on the cell surface yet not easy to isolate.21 For this reason, a flow-cytometry assay was used to evaluate both the binding capability and toxicity of our Bis-Ab using the gating strategy in Figure S11. KG1 and KG1/RAP cell lines were treated with the various Bis-Ab mixtures. Binding percentage was calculated from the percentage of IgG positive cells, where the secondary IgG antibody is bound to the primary Bis-Ab. The TF1RAPa Bis-Ab showed the highest binding in KG1/RAP cells (Figure 3A) as compared to other mixtures (p<0.001). In contrast, the TF1RAPb antibody revealed slightly reduced binding in KG1/RAP cells. On treating KG1/RAP cells with increasing amounts of TF1RAPa, more binding to the dual-positive KG1/RAP cells was observed (Figure 3B). To demonstrate the specificity of the Bis-Ab, we measured the competition with the CD176 and the IL1RAP monoclonal antibodies. Increasing concentrations of the Bis-Ab specifically inhibited the binding of both the IL1RAP and CD176 mAbs (Figure S12). Then, our KG1/RAP cells were treated with the Bis-Ab TF1RAPa and complement prior to staining with the LIVE/DEAD Fixable Aqua Dead Cell Stain Kit, in order to evaluate whether CDC could be achieved using IL1RAP and CD176 as targets. Flow cytometric analysis revealed a significant increase in dead cells in the Bis-Ab treated CD176/IL1RAP dual-positive KG1/RAP population as antibody binding also increased (Figure 3C), p<0.001.

Figure 3 Validation of TF-RAP Bi-specific antibody in KG1 cell line and CML samples. (A) MFI for binding of different Bis-Ab mixtures in KG1/RAP (p <0.001). (B) Binding (%) of the Bis-Ab in KG1/RAP cell lines. (C) Shows live/dead (LD) staining (%) in KG1/RAP cell lines after treatment with the Bis-Ab and complement. (D) MFI for binding of different Bis-Ab mixtures p <0.001 in CML cells. (E) Binding of the Bis-Ab (%) in PBMCs from patients with CML. The binding affinity (Kd) of our bispecific antibody was 21ng/mL, calculated using the % RO = [Ab]/([Ab]+Kd) 100%, where RO is the receptor occupancy, Ab is the concentration of antibody, and Kd is the equilibrium dissociation constant. This Bis-Ab platform used in this study had the correct molecular weight (95 KDa) and assembled properly (93%) as revealed by SDS-PAGE analysis.38 (F) Live/dead (L/D) staining (%) from patients with CML after treatment with the Bis-Ab and complement. The red square were L/D positive cells treated with CyO2; the percent of L/D staining in normal PBMCs is shown in blue. Each point represents the mean increase in L/D staining SEM with three to four replicates. Data from normal samples were low for all doses (data not shown).

Binding of TF1RAPa, TF2RAPa, and TF2RAPb was also tested in PBMCs from patients with CML. Again, TF1RAPa showed the highest binding relative to other mixtures (p<0.001) (Figure 3D) and with increasing doses (Figure 3E). Based on the CML binding curve, the binding affinity (Kd) of our bispecific antibody was 21 ng/mL. Other therapeutic antibodies, such as ofatumumab directed against CD20, have shown significant CDC against peripheral blood cells obtained from CML patients in chronic phases26 and B cells in CLL,29 respectively. Thus, the TF1RAPa cocktail was used to generate the doseresponse curve and to evaluate whether CDC could be achieved using both IL1RAP and CD176 as targets. The ability of the TF1RAPa cocktail was compared to human anti-IL1RAP and anti-CD176 monoclonal antibodies to induce cell death in PBMCs from patients with CML. PBMCs from CML1-4 were tested in CDC assays in parallel to cells from healthy control samples. In CML cells, the binding of TF1RAPa mediated CDC at higher levels than in normal peripheral blood mononuclear control cells, correlating with the expression level of IL1RAP and CD176, particularly at lower antibody concentrations (Figure 3F). More strikingly, among peripheral blood cells, TF1RAPa did not induce CDC of normal cells, whereas a clear dose-dependent CDC effect was observed in CML cells (Figure S13A and B). To address the selectivity of IL1RAP/CD176-targeting antibodies, we also validated the bispecific antibody cytotoxicity on the various subpopulations in peripheral blood. The dual-positive CD176+IL1RAP+ cell populations showed the highest CDC activity as compared to CD176+IL1RAP-, CD176-IL1RAP+, and CD176-IL1RAP- populations (Figure 4 and S13CF, S14).

Figure 4 Dose-response curve of TF1RAPa Bis-Ab on CDC in CML samples. A dose-response curve showing the selective killing potential of CD176+IL1RAP+ subpopulation by the TF1RAPa Bis-Ab as compared to other subpopulations in PBMCs from patients with CML. Each point represents the mean SEM of the four samples.

Targeting molecules involved in multiple pathways is proving to be one of the most reliable strategies for eradicating cancer stem cells. In this report, we present a novel bi-specific antibody, TF/RAP, capable of targeting ThomsenFriedenreich (TF, CD176) and IL1RAP antigens on CD34+ HSCs in CML and on cell lines. TF is a glycoprotein that has many domains and motifs (eg, LGALS3, Gal(1,3)GalNAc, LGalS3BP), many related to signaling pathways. It is a known marker for ongoing tumorigenesis and metastasis, as it is expressed on various cancer-initiating cells.8 Interestingly, CD34 and LGALS3 were found to be co-expressed in myeloid cells.30,31 LGALS3 and ABL1 are involved in regulating RUNX1 and the transcription of genes involved in differentiation of hematopoietic stem cells,32 especially myeloid cells33 (Figure S15) IL1RAP, on the other hand, is a member of the Toll-like receptor superfamily and is a well-known co-receptor of IL1R1.34 IL1RAP plays a role in mediating the effect of the pro-inflammatory cytokine IL-1 and is also involved in activating T cells and mast cells after mediating the signal of IL-1 cytokine.35 It has previously been characterized as a tightly related marker for BCR-ABL positive cells.7 Together, both TF and IL1RAP were related to apoptotic pathways; IL1RAP up-regulation was associated with decreased apoptosis in AML,36 and anti-CD176 antibody induced apoptosis of CD176-positive leukemic cells through multiple pathways.12 Although we did not find a direct link between IL1RAP, CD176 and leukemogenesis, previous studies have shown that each of them is separately expressed on CD34+ cells in leukemia cell lines8,10,12 and patients with CML7

Therefore, we conducted this pilot study, in order to assess the co-expression of IL1RAP and ThomsenFriedenreich (CD176) antigens on CD34+ HSCs in peripheral blood of patients with CML, using FACS gene expression analyses. Flow-drop FISH and CFU assays were used for the separation of CD34+CD176 BCR-ABL+ and BCR-ABL CML stem cells, based on IL1RAP expression.7 CFU numbers were significantly lower in CD34+CD176+IL1RAP- cells than in CD34+CD176+IL1RAP+ cells, obtained from CML-2 and CML-4 samples (Figure 1D), particularly CML-2 sample which was obtained from a patient in remission (BCR-ABL-). We found that the frequency of clonogenic hematopoietic progenitor cells was increased in the CD34+ CD176+IL1RAP+ cells in these samples. Testing the stem-cell characteristics of these two cell populations in immune-deficient mice would have been advantageous. Yet, the low numbers of sorted CML cells acquired from the CD34+CD176+ IL1RAP and IL1RAP+ cell subpopulations, alongwith the general low engrafting efficiency of chronic phase CML cells in these mice7 prevented us from successfully performing such experiments. Importantly, as IL1RAP expression was correlated with changes from chronic phase (CP) into accelerated phase (AP) and blast phase (BP)37, we also found that the level of IL1RAP/CD176 co-expressionwas increased, in our patient samples, as the disease progressed, independent of the treatment status(Table S3).

To target both TF and IL1RAP simultaneously, we developed a Bis-Ab specific for both antigens. Because antibodies are normally heterodimers of two heavy and two light chains, we modified the constant domains in the Bis-Ab to maximize the correct interactions of the four immunoglobulin chains within single cells. Here, we used the orthogonal Fab design; CH1_H172A_F174G and CL_L135Y_S176W38 to facilitate selective assembly of the Fab arms for correct dimerization of the antigen-binding domains.39 Therefore, we mutated CH1 and CL binding sites to restrict the assembly of the Fab with the correct VD pairs. The RAP VDs were cloned with the wild type Fab; and the TF VD was linked to the mutant orthogonal Fab design. Published data have shown that the component proteins of this Bis-Ab platform proper assembly were detected at 93% and the complex had a molecular weight of 95 KDa, as revealed by SDS-PAGE analysis.38 Additionally, the CH3 for each Fab was mutated with previously described knob-into-hole mutations40,41 to facilitate hetero-dimerization between the TF and the RAP heavy chains. In our study, we used ELISA to demonstrate that both the VD and Fc were properly paired. Here, because the primary antibody was anti-human VL and the secondary antibody was anti-human IgG, quantifying the Bis-Ab also demonstrated the VD-Fc interactions.

To efficiently validate the specific binding of our Bis-Ab, we generated a dual-positive cell line; KG1/RAP. KG1 cell line expresses CD176+, but IL1RAP is low or absent. Therefore, we induced IL1RAP expression in KG1 cells by lentiviral mediated-gene transfer, as previously usedin both immune42 and leukemic cells.43 In the competitive binding assay, increasing concentrations of the Bis-Ab blocked the binding of CD176 and IL1-RAP monoclonal antibodies to the KG1/RAP and KG1 parental cells, demonstrating the specific binding of the Bis-Ab. The level of CD176 expression in KG1 cell line was detected before and after VCN treatment. Increased staining of the KG1/RAP cells compared to the parental KG1 cells indicated that expression of the IL1RAP facilitates the interaction of the Bis-Ab with the target cell. This increased binding of the Bis-Ab to the KG1/RAP cells also increased their susceptibility to complement-dependent cytotoxicity (CDC). We also observed increased binding and increased CDC in the CD176+ IL1RAP+ population of the peripheralblood from patients with CML. As a pilot study and given that on average, 50% of the cells within the CD34+ subpopulation in the patients tested were dual positive for CD176 and IL1RAP antigens, in addition to the almost undetectable CDC in CD34+ cells in normal controls, our data strongly support the idea that the bi-specific antibody (TF/RAP) indeed induces CDC preferentially in CD176+ IL1RAP+ CML CD34+ cells. In generating a bi-specific antibody that targets CD176 and IL1RAP, we are unique in providing proof of concept that CML CD34+CD176+ IL1RAP+ cells can be targeted while preserving corresponding normal cells. The potential to target multiple antigens is supported by studies that demonstrated increased or synergistic CDC activity by non-cross blocking CD20 antibody combinations.44

Therapeutic antibodies are commonly administered intravenously, yet selectivity and specificity are a major concern for reduced toxicity. CD176/IL1RAP co-expression was not present in monocytes unlike the reported weak but present IL1RAP expression in monocytes.7 Both antigens were low or absent in most types of normal bone-marrow progenitor and mature cell types, suggesting that CD176/IL1RAP dual targeting antibodies are expected to show low toxicity on normal hematopoietic cells. Being strongly expressed on the surface of cancer cells and virtually absent from normal tissues, CD176 was evaluated as a potential target for cancer biotherapy with the development of anti-CD176 antibody that induced apoptosis of leukemic cells.8 Added to this, antibodies against IL1RAP were found to be capable of blocking IL-1 signaling as well as inhibiting tumor cells' growth in AML,34 CML,7 breast cancer,45 prostate cancer, breast cancer, lung cancer, colorectal cancer, melanomas, bladder cancer, brain/CNS cancer, cervical cancer, esophageal cancer, gastric cancer, head/neck cancer, kidney cancer, liver cancer, lymphomas, ovarian cancer, pancreatic cancer, and sarcomas46 especially in cancer stem cells, or (CSCs) and progenitor cells, which are responsible, directly or indirectly, for the development of a solid tumor.47 Thus, it may be thatour Bis-Ab will not only eradicate the CD176+IL1RAP+ drug-resistantCML stem cells but also may have universal therapeutic potential for preventing relapses in both solid and hematological cancers.Given that the mode of action in CDC is having the antibody direct the complement pathway to target cell killing, we suggest that this therapeutic strategy would be independent of known mechanisms of TKI resistance in CML. Thus, the concept of complement-mediated killing of IL1RAP/CD176 expressing cells may also have the potential to eradicate such cells in patients, either alone or in combination with current regimens, in order to increase their therapeutic effectiveness. And finally, expanded studies need to be performed in order to confirm the co-expression of both markers, especially in resistant and relapsed cancer patients as well as in patient-derived xenografts (PDX).

The experimental research was mostly supported by a fellowship to REE from the Egyptian Ministry of Higher Education, Cultural, and Missions Section (JS 3577). The lentiviral vectorHRST-cmvGFPand the packaging plasmids were akind gift from Richard C.Mulligan in the Harvard Gene Therapy Institute. The human IgG heavy and light chain constant genes were provided by JE Robinson (Tulane University). C Wu and SEB were supported by AI110158 and/or OD01104-51; EUA and SEB were supported by the Applied Stem Cell Laboratory.

All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work. All authors have given approval of the final version of the article; and have agreed to be accountable for all aspects of the work.

The abstract of this paper was presented at the AACR annual Meeting 2019; March 29 April3, 2019; Atlanta, GA, as a poster presentation with interim findings. The posters abstract was published in Poster Abstracts in the AACR meeting proceedings and as a supplement in the AACR Cancer Research Journal [https://cancerres.aacrjournals.org/content/79/13_Supplement/1222A].

Raghda Eldesouki reports grants from Egyptian Ministry of Higher Education. Stephen EBraun reports grants from Egyptian Ministry of Education, Alliance for Cardiovascular Research, NIAID OD01104, and Braun/McGroarty Charitable Fund, during the conduct of the study. In addition, Dr Raghda Eldesouki, Dr Stephen Braun, Dr Fouad Badr and Dr Eman Abdel-Moemen Mohammedhave apatent, PCT/EG2019/000014, pending. The authors report no other conflicts of interest in this work.

1. Marchetti M. Cost-effectiveness of kinase inhibitors for hematologic malignancies: a systematic and critical review. Expert Rev Pharmacoecon Outcomes Res. 2017;17(5):469480. doi:10.1080/14737167.2017.1366858

2. Holyoake TL, Helgason GV. Do we need more drugs for chronic myeloid leukemia? Immunol Rev. 2015;263(1):106123.

3. Zhou H, Xu R. Leukemia stem cells: the root of chronic myeloid leukemia. Protein Cell. 2015;6(6):403412.

4. Holyoake TL, Vetrie D. The chronic myeloid leukemia stem cell: stemming the tide of persistence. Blood. 2017;129(12):15951606. doi:10.1182/blood-2016-09-696013

5. Koptyra M, Falinski R, Nowicki MO, et al. BCR/ABL kinase induces self-mutagenesis via reactive oxygen species to encode imatinib resistance. Blood. 2006;108(1):319327. doi:10.1182/blood-2005-07-2815

6. Tasian SK, Bornhuser M, Rutella S. Targeting leukemia stem cells in the bone marrow niche. Biomedicines. 2018;6(1):22. doi:10.3390/biomedicines6010022

7. Jrs M, Johnels P, Hansen N, et al. Isolation and killing of candidate chronic myeloid leukemia stem cells by antibody targeting of IL-1 receptor accessory protein. Proc Natl Acad Sci U S A. 2010;107(37):1628016285. doi:10.1073/pnas.1004408107

8. Goletz S, Cao Y, Danielczyk A, Ravn P, Schoeber U, Karsten U. Thomsen-Friedenreich antigen: the hidden tumor antigen. Adv Exp Med Biol. 2003;535:147162.

9. Kurtenkov O, Innos K, Sergejev B, Klaamas K. The Thomsen-Friedenreich antigen-specific antibody signatures in patients with breast cancer. Bio Med Res Int. 2018;2018:9579828.

10. Sindrewicz P, Lian LY, Yu LG. Interaction of the onco-fetal Thomsen-Friedenreich antigen with galectins in cancer progression and metastasis. Front Oncol. 2016;6:79. doi:10.3389/fonc.2016.00079

11. Lin WM, Karsten U, Goletz S, Cheng RC, Cao Y. Expression of CD176 (Thomsen-Friedenreich antigen) on lung, breast, and liver cancer-initiating cells. Int J Exp Pathol. 2011;92(2):97105. doi:10.1111/j.1365-2613.2010.00747.x

12. Yi B, Zhang M, Schwartz-Albiez R, Cao Y. Mechanisms of the apoptosis induced by CD176 antibody in human leukemic cells. Int J Oncol. 2011;38:15651573.

13. Fan G, Wang Z, Hao M, Li J. Bi-specific antibodies and their applications. J Hematol Oncol. 2015;8:130. doi:10.1186/s13045-015-0227-0

14. Varela MA. Identification of sequences common to more than one therapeutic target to treat complex diseases: simulating the high variance in sequence interactivity evolved to modulate robust phenotypes. BMC Genom. 2015;16(1):530. doi:10.1186/s12864-015-1727-6

15. Wu C, Lu Y. High-titre retroviral vector system for efficient gene delivery into human and mouse cells of hematopoietic and lymphocytic lineages. J Gen Virol. 2010;91(8):19091918. doi:10.1099/vir.0.020255-0

16. Ge D, Zhang QS, Zabaleta J, et al. Doublecortin may play a role in defining chondrocyte phenotype. Int J Mol Sci. 2014;15(4):69416960. doi:10.3390/ijms15046941

17. Braun SE, Wong FE, Connole M, et al. Inhibition of simian/human immunodeficiency virus replication in CD4+ T cells derived from lentiviral-transduced CD34+ hematopoietic cells. Mol Ther. 2005;12(6):11571167. doi:10.1016/j.ymthe.2005.07.698

18. Braun SE, Lu XV, Wong FE, et al. Potent inhibition of simian immunodeficiency virus (SIV) replication by an SIV-based lentiviral vector expressing antisense Env. Hum Gene Ther. 2007;18(7):653664. doi:10.1089/hum.2007.003

19. Robinson JE, Hastie KM, Cross RW, et al. Most neutralizing human monoclonal antibodies target novel epitopes requiring both Lassa virus glycoprotein subunits. Nat Commun. 2016;7:11544. doi:10.1038/ncomms11544

20. Goltez S, Karasten U Cancer stem cell markers and uses thereof. WIPO, WO2011089004A1 2011 Jul 28.

21. Jiang Y, Tso J, Karsunky H. Antibodies that bind membrane-bound IL1rap. European patent EP2935334A1. 2015 Oct 28.

22. Keaglen MB, Gersen SL. Basic cytogenetics laboratory procedures. In: Gersen SL, Keagle MB, editors. The Principles of Clinical Cytogenetics. NewYork, NY: Springer NewYork; 2013:5365.

23. International Standing Committee on Human Cytogenetic Nomenclature. ISCN2016: An International System for Human Cytogenetic Nomenclature. Karger Medical and Scientific Publishers; 2016.

24. Broxmeyer HE, Etienne-Julan M, Gotoh A, et al. Hematopoietic colony formation from human growth factor-dependent TF1 cells and human cord blood myeloid progenitor cells depends on SHP2 phosphatase function. Stem Cells Dev. 2013;22(6):9981006. doi:10.1089/scd.2012.0478

25. Balduini A, Broxmeyer HE, Braun SE, Cornetta K, Lyman S. Comparative effects of retroviral mediated gene transfer into primary human stromal cells of flt3ligand, interleukin 3 and gmcsf on production of cord blood progenitor cells in longterm culture. Stem Cells. 1998;16:3749. doi:10.1002/stem.5530160807

26. Tatake RJ, Maniar HS, Chiplunkar SV, et al. Antibody-dependent cellular cytotoxicity and complement-mediated cytotoxicity on leukemic cells mediated by anti K562 monoclonal antibodies. J Clin Lab Immunol. 1990;31(2):8791.

27. Lindorfer MA, Beum PV, Taylor RP. CD20 mAb-mediated complement dependent cytotoxicity of tumor cells is enhanced by blocking the action of factor I. Antibodies. 2013;2:598616. doi:10.3390/antib2040598

28. Gerlach SL, Chander PK, Roy U, et al. The membrane-active phytopeptide. Cycloviolacin O2 simultaneously targets HIV1-infected cells and infectious viral particles to potentiate the efficacy of antiretroviral drugs. Medicines (Basel). 2019;6(1):E33. doi:10.3390/medicines6010033

29. Zen CS, Secreto CR, LaPlant BR, et al. Direct and complement dependent cytotoxicity in CLL cells from patients with high-risk early-intermediate stage chronic lymphocytic leukemia (CLL) treated with alemtuzumab and rituximab. Leuk Res. 2008;32(12):18491856. doi:10.1016/j.leukres.2008.05.014

30. Marer N. Galectin3 expression in differentiating human myeloid cells. Cell Biol Int. 2000;24:245251. doi:10.1006/cbir.1999.0501

31. Labbaye C, Testa U. The emerging role of MIR-146A in the control of hematopoiesis, immune function and cancer. J Hematol Oncol. 2012;5:13. doi:10.1186/1756-8722-5-13

32. Huang H, Woo AJ, Waldon Z, et al. A Src family kinase-Shp2 axis controls RUNX1 activity in megakaryocyte and T-lymphocyte differentiation. Genes Dev. 2012;26(14):15871601. doi:10.1101/gad.192054.112

33. Zhang HY, Jin L, Stilling GA, et al. RUNX1 and RUNX2 upregulate Galectin-3 expression in human pituitary tumors. Endocrine. 2009;35(1):101111. doi:10.1007/s12020-008-9129-z

34. gerstam H, Karlsson C, Hansen N, et al. Antibodies targeting human IL1RAP (IL1R3) show therapeutic effects in xenograft models of acute myeloid leukemia. Proc Natl Acad Sci U S A. 2015;112(34):1078610791.

35. McEntee CP, Finlay CM, Lavelle EC. Divergent roles for the IL-1 family in gastrointestinal homeostasis and inflammation. Front Immunol. 2019;10:1266.

36. Barreyro L, Will B, Bartholdy B, et al. Over expression of IL-1 receptor accessory protein in stem and progenitor cells and outcome correlation in AML and MDS. Blood. 2012;120(6):12901298. doi:10.1182/blood-2012-01-404699

37. Zhao K, Yin LL, Zhao DM, et al. IL1RAP as a surface marker for leukemia stem cells is related to a clinical phase of chronic myeloid leukemia patients. Int J Clin Exp Med. 2014;7(12):47874798.

38. Lewis SM, Wu X, Pustilnik A, et al. Generation of bi-specific IgG antibodies by structure-based design of an orthogonal Fab interface. Nat Biotechnol. 2014;32:191198. doi:10.1038/nbt.2797

39. Spidel JL, Vaessen B, Chan YY, Grasso LJ, Kline B. Rapid high-throughput cloning and stable expression of antibodies in HEK293 cells. J Immunol Methods. 2016;439:5058. doi:10.1016/j.jim.2016.09.007

40. Ridgway JB, Presta LG, Carter P. Knobs-into-holes engineering of antibody CH3 domains for heavy chain heterodimerization. Protein Eng. 1996;9:617621. doi:10.1093/protein/9.7.617

41. Atwell S, Ridgway JB, Wells JA, Carter P. Stable heterodimers from remodeling the domain interface of a homodimer using a phage display library. J Mol Biol. 1997;270:2635. doi:10.1006/jmbi.1997.1116

42. Pan H, Mostoslavsky G, Eruslanov E, Kotton DN, Kramnik I. Dual-promoter lentiviral system allows inducible expression of noxious proteins in macrophages. J Immunol Methods. 2007;329(12):3144. doi:10.1016/j.jim.2007.09.009

43. Biagi E, Bambacioni F, Gaipa G, et al. Efficient lentiviral transduction of primary human acute myelogenous and lymphoblastic leukemia cells. Haematologica. 2001;86(1):1316.

44. Melis JP, Strumane K, Ruuls SR, Beurskens FJ, Schuurman J, Parren PW. Complement in therapy and disease: regulating the complement system with antibody-based therapeutics. Mol Immunol. 2015;67:117130. doi:10.1016/j.molimm.2015.01.028

45. Liberg D, nnervik P, Riva M, Larsson L, Forsberg G, Wachenfeldt K. Antibody Blockade of IL1RAP Signaling Reduces Metastasis in a Breast Cancer Model. Annual Meeting of the American Association for Cancer: McCormick Place North/South Chicago, Illinois, USA; 2018.

46. Fioretos T, Jaras M Method of treatment of a solid tumor with interleukin-1 accessory protein antibody. United States patent US 9403906B2. 2016 Aug 02.

47. Fioretos T, Jaras M. Anti - IL1rap antibodies and their use for treating human. European patent EP2665749A1. 2013 Nov 27.

Originally posted here:
[Full text] Identification and Targeting of ThomsenFriedenreich and IL1RAP | OTT - Dove Medical Press

Amsterdam, The Netherlands, January 22, 2021 – Kiadis Pharma N.V. ("Kiadis" or the "Company") (Euronext Amsterdam and Brussels: KDS), a clinical-stage biopharmaceutical company developing innovative NK-cell-based medicines for the treatment of life-threatening diseases, today announces that four abstracts related to its K-NK-cell therapy platform were accepted for presentation at the TCT Meetings, the Transplantation & Cellular Therapy Meetings of the American Society of Transplantation and Cellular Therapy (ASTCT) and Center for International Blood & Marrow Transplant Research (CIBMTR), which is being held virtually from February 8–12, 2021.

View post:
Kiadis announces multiple abstracts related to its K-NK-cell therapy platform have been accepted for presentation at TCT, the Combined Transplantation...

By Deborah Borfitz

January 13, 2021 | As aging researchers are aware, birthday candles are not a good guide to either human health or longevity. But there is an abundance of clues in the genome and, as suggested by studies in animals, some of age-related damage is reversible by removing or reprogramming problematic cells or blocking the activity of key proteins.

As it turns out, DNA methylationa frequently-used biomarker of biological ageis not just marking time like a clock on the wall but actually controlling time within cells, according to David Sinclair, an expert on aging at Harvard Medical School and cofounder of 4-year-old Life Biosciences. The revelation emerged from a study recently published in Nature (DOI: 10.1038/s41586-020-2975-4) where Harvard researchers showed, for the first time, that the pattern of DNA methylation in the genome can be safely reset to a younger age.

It was in fact a prerequisite to restoring youthful function and vision in old mice, says Sinclair, who has spent most of his adult life studying the epigenetic changes associated with aging. Up until a few years ago, he thought the process was unidirectional and that cells ultimately lost their identity and malfunctioned or became cancerous.

It seemed crazy to try to get proteins to return to the place they were in young cells, Sinclair says. Proteins move around in response to age-associated DNA damage and end up in the wrong places on the genome, causing the wrong genes to be turned on, but scientists did not know if proteins could go back, where the instructions were stored, or if they were being stored at all.

As covered in his 2019 bestseller Lifespan, Sinclair now believes that aging is the result of the so-called epigenetic changes scrambling how the body reads genetic code. Were essentially looking for the polish to get the cell to read the genome correctly again, he says, a process he likens to recovering music on a scratched CD.

Yamanaka Factors

Sinclair and his research associates have been focusing on the eye, in part because retinal tissues start aging soon after birth, he explains. While a damaged optic nerve can heal in a newborn, the injury is irreversible in a 1-year-old.

Yuancheng Lu, a former student of Sinclairs, was also interested in the eye because his family has a vision-correction business and recognized sight loss as a huge unmet need, he continues. We thought if we could take the age of those retinal cells back far enough, but not so far that they lose their identity, we might be able to see regrowth of the optic nerve if it was damaged.

Among the foundational work was a 2016 study in Cell (DOI: 10.1016/j.cell.2016.11.052) by Life Biosciences cofounder Juan Carlos Izpisua Belmonte (Salk Institute for Biological Studies) who partially erased cellular markers of aging in mice that aged prematurely, as well as in human cells, by turning on Yamanaka factors Oct4, Sox2, Klf4, and c-Myc (OSKM) highly expressed in embryonic stem cells. Short-term induction of OSKM ameliorated hallmarks of aging and modestly extended lifespan in the short-lived mice.

The lifespan gain was widely dismissed as an artifact of shocking a mouse, says Sinclair, since the mice died if the treatment continued for more than two days. Although the human health implications appeared unlikely, his Harvard team decided to try the approach using an adeno-associated virus as a vehicle to deliver the youth-restoring OSKM genes into the retinas of aging mice.

The technology kept killing the mice or causing them to get cancer until Lu decided to drop the c-Myc genean oncogenein his experiments using human skin cells. He looked at [damaged] cells that had been expressing OSK for three weeks and the nerves were growing back toward the brain to an unprecedented degree. Moreover, the cells got older by the damage and younger by the treatment.

As the broader team went on to show in the Nature paper, the trio of Yamanaka factors effectively made cells younger without causing them to lose their identity (i.e., turning back into induced pluripotent stem cells) or fueling tumor growth even after a year of continuous treatment of the entire body of a mouse. If anything, the mice had fewer tumors over the course of the study, says Sinclair.

Although the mice needed to be autopsied to definitively measure tumor burden, Sinclair says the study will be repeated to learn if the epigenetic reprogramming technique can increase lifespan.

Findings have implications beyond the treatment of age-related diseases specific to the eye, says Sinclair. Aging researchers have published studies showing other types of tissues, including muscle and kidney cells, can also be rejuvenated.

Clocked Results

In the latest study using mice, epigenetic reprogramming was found to have three beneficial effects on the eye: promotion of optic nerve regeneration, reversal of vision loss with a condition mimicking human glaucoma, and reversal of vision loss in aging animals without glaucoma. The latter finding, from Sinclairs vantage point, is the most important one. This is ultimately a story about finding a repository of youthful information in old cells that can reverse aging.

Results of all three experiments are noteworthy and have commonly thought to be three separate processes, says Sinclair. That is only because the fields of aging and acute and chronic disease are distinct disciplines that rarely talk to each other.

The Harvard team is pioneering a new way to tackle diseases of aging by addressing the underlying cause. This is the first time, as far as Sinclair is aware, where nerve damage was studied in old rather than young animals. In the case of glaucoma and most diseases, aging is considered largely irrelevant, when of course we know glaucoma is a disease of aging.

A variety of aging clocks, including some the research team built themselves, have been deployed for studies because they are considered the most accurate predictor of biological age and future health, says Sinclair. As embryos, cells lay down different patterns of methylation to ensure they remember their purpose over the next 80 to 100 years.

For unknown reasons, methyl groups get predictably added and subtracted from DNA bases across cell and tissue types and even species, Sinclair says. In 2013, UCLAs Steve Horvath (another Life Biosciences cofounder) showed that machine learning could be used to pick out the hot spots and predict individual lifespan depending on how far above or below the DNA methylation line they sit (Genome Biology, DOI: 10.1186/gb-2013-14-10-r115).

A multitude of aging clocks have since been developed. Eventually, we will need some standardization in the field, but there is nothing super-mysterious about aging clocks, says Sinclair. One of my grad students could probably get you one by the end of the day.

Booming Field

Aging research is a rapidly accelerating field and epigenetic reprogramming is poised to become a particularly active area of inquiry. In terms of numbers, there are still only a dozen or so labs intensely working on this, but there are probably a hundred others I am aware of who are getting into it, says Sinclair.

Life Biosciences began with four labs, but new ones are now joining on an almost weekly basis, he adds. Collaborators have expanded work to the ear and other areas of the body beyond the eye, he adds.

Were also reducing the cost of the DNA clock test by orders of magnitude so [biological age prediction] can be done on millions of people, he continues. In the future, aging clocks are expected to be a routine test in physicians arsenal to guide patient care as well as to monitor response to cancer treatment.

Harvard University has already licensed two patents related to the technology used by the aging researchers to Life Biosciences, Sinclair says. The company has built a scientific team with a group of world-class advisors who developed gene therapy for the eye, which will be tested first for the treatment of glaucoma.

The role of chaperone-mediated autophagy in aging and age-related diseases is another promising area of research being pursued by Life Biosciences Ana Maria Cuervo, M.D, Ph.D., professor, and co-director of the Institute of Aging Studies at the Albert Einstein College of Medicine. Cuervo recently reported at a meeting that fasting-induced autophagy, the cells natural mechanism for removes unnecessary or dysfunctional components, can greatly extend the lifespan of mice. She believes the triggering of this process might one day help treat diseases such as macular degeneration and Alzheimers.

The specialty of Manuel Serrano, Ph.D., the fourth company cofounder, is cellular senescence and reprogramming and how they relate to degenerative diseases of the lung, kidney, and heart. He isan internationally recognized scientist who has made significant contributions to cancer and aging research and works in the Institute for Research Biomedicine in Barcelona.

The rest is here:
Reversing The Aging Clock With Epigenetic Reprogramming - Bio-IT World

Stem cell assay refers to the procedure of measuring the potency of antineoplastic drugs, on the basis of their capability of retarding the growth of human tumor cells. The assay consists of qualitative or quantitative analysis or testing of affected tissues and tumors, wherein their toxicity, impurity, and other aspects are studied.

With the growing number of successful stem cell therapy treatment cases, the global market for stem cell assays will gain substantial momentum. A number of research and development projects are lending a hand to the growth of the market. For instance, the University of Washingtons Institute for Stem Cell and Regenerative Medicine (ISCRM) has attempted to manipulate stem cells to heal eye, kidney, and heart injuries. A number of diseases such as Alzheimers, spinal cord injury, Parkinsons, diabetes, stroke, retinal disease, cancer, rheumatoid arthritis, and neurological diseases can be successfully treated via stem cell therapy. Therefore, stem cell assays will exhibit growing demand.

Get Brochure of the Report @ https://www.tmrresearch.com/sample/sample?flag=B&rep_id=40

Another key development in the stem cell assay market is the development of innovative stem cell therapies. In April 2017, for instance, the first participant in an innovative clinical trial at the University of Wisconsin School of Medicine and Public Health was successfully treated with stem cell therapy. CardiAMP, the investigational therapy, has been designed to direct a large dose of the patients own bone-marrow cells to the point of cardiac injury, stimulating the natural healing response of the body.

Newer areas of application in medicine are being explored constantly. Consequently, stem cell assays are likely to play a key role in the formulation of treatments of a number of diseases.

Global Stem Cell Assay Market: Overview

The increasing investment in research and development of novel therapeutics owing to the rising incidence of chronic diseases has led to immense growth in the global stem cell assay market. In the next couple of years, the market is expected to spawn into a multi-billion dollar industry as healthcare sector and governments around the world increase their research spending.

The report analyzes the prevalent opportunities for the markets growth and those that companies should capitalize in the near future to strengthen their position in the market. It presents insights into the growth drivers and lists down the major restraints. Additionally, the report gauges the effect of Porters five forces on the overall stem cell assay market.

Global Stem Cell Assay Market: Key Market Segments

For the purpose of the study, the report segments the global stem cell assay market based on various parameters. For instance, in terms of assay type, the market can be segmented into isolation and purification, viability, cell identification, differentiation, proliferation, apoptosis, and function. By kit, the market can be bifurcated into human embryonic stem cell kits and adult stem cell kits. Based on instruments, flow cytometer, cell imaging systems, automated cell counter, and micro electrode arrays could be the key market segments.

In terms of application, the market can be segmented into drug discovery and development, clinical research, and regenerative medicine and therapy. The growth witnessed across the aforementioned application segments will be influenced by the increasing incidence of chronic ailments which will translate into the rising demand for regenerative medicines. Finally, based on end users, research institutes and industry research constitute the key market segments.

The report includes a detailed assessment of the various factors influencing the markets expansion across its key segments. The ones holding the most lucrative prospects are analyzed, and the factors restraining its trajectory across key segments are also discussed at length.

Global Stem Cell Assay Market: Regional Analysis

Regionally, the market is expected to witness heightened demand in the developed countries across Europe and North America. The increasing incidence of chronic ailments and the subsequently expanding patient population are the chief drivers of the stem cell assay market in North America. Besides this, the market is also expected to witness lucrative opportunities in Asia Pacific and Rest of the World.

Get Table of Content of the Report @ https://www.tmrresearch.com/sample/sample?flag=T&rep_id=40

Global Stem Cell Assay Market: Vendor Landscape

A major inclusion in the report is the detailed assessment of the markets vendor landscape. For the purpose of the study the report therefore profiles some of the leading players having influence on the overall market dynamics. It also conducts SWOT analysis to study the strengths and weaknesses of the companies profiled and identify threats and opportunities that these enterprises are forecast to witness over the course of the reports forecast period.

Some of the most prominent enterprises operating in the global stem cell assay market are Bio-Rad Laboratories, Inc (U.S.), Thermo Fisher Scientific Inc. (U.S.), GE Healthcare (U.K.), Hemogenix Inc. (U.S.), Promega Corporation (U.S.), Bio-Techne Corporation (U.S.), Merck KGaA (Germany), STEMCELL Technologies Inc. (CA), Cell Biolabs, Inc. (U.S.), and Cellular Dynamics International, Inc. (U.S.).

About TMR Research

TMR Research is a premier provider of customized market research and consulting services to business entities keen on succeeding in todays supercharged economic climate. Armed with an experienced, dedicated, and dynamic team of analysts, we are redefining the way our clients conduct business by providing them with authoritative and trusted research studies in tune with the latest methodologies and market trends.

Contact:

Rohit Bhisey

TMR Research,

3739 Balboa St # 1097,

San Francisco, CA 94121

United States

Tel: +1-415-520-1050

Visit Site: https://www.tmrresearch.com/

Read more:
Stem Cell Assay Market | Know the aspects that will serve as game-changers for the market - BioSpace

-- MGTA-145: Three Phase 2 clinical trials ongoing or planned to evaluate MGTA-145, a biologic used in combination with plerixafor to mobilize stem cells; the first clinical trial in patients with multiple myeloma (initial data expected in mid-2021); the first clinical trial with matched donors and patients with acute myeloid leukemia (AML), acute lymphocytic lymphoma (ALL) and myelodysplastic syndromes (MDS) (data expected in the second half of 2021); and the first clinical trial in patients with sickle cell disease (trial initiation expected in the second half of 2021)

-- MGTA-117: Completing GLP toxicology and GMP manufacturing of targeted conditioning antibody-drug conjugate, MGTA-117; plans to initiate clinical trial in acute myeloid leukemia and myelodysplastic syndromes in mid-2021

-- Five abstracts from across Magentas pipeline, including four oral presentations, will be presented at the Transplantation and Cellular Therapy (TCT) Annual Meeting, to be held virtually February 8-12, 2021

-- Magenta also has announced the appointment of experienced biotech executive Alison Lawton to its Board of Directors --

-- Ended 2020 with cash reserves of approximately $145 million that are expected to fund the current operating plan into 2023 --

CAMBRIDGE, Mass.--(BUSINESS WIRE)--Magenta Therapeutics (NASDAQ: MGTA), a clinical-stage biotechnology company developing novel medicines to bring the curative power of immune and blood systems reset via stem cell transplant to more patients, today highlighted progress across its stem cell mobilization and collection and targeted conditioning programs, and set expectations for 2021. These updates will be discussed during a webcast presentation at the 39th Annual J.P. Morgan Healthcare Conference on Thursday, January 14 at 7:50 a.m. PST / 10:50 a.m. EST.

Im exceptionally proud of the entire Magenta team who continued to adapt and execute across our portfolio, despite the disruptions that characterized 2020. This past year, we continued to drive our vision to bring immune and blood systems reset to more patients. We announced four pipeline-expanding partnerships, presented clinical and pre-clinical data across our pipeline and secured the capital that we expect can fund our operations into 2023. We continue to advance four ongoing and planned clinical trials that we believe can advance our portfolio in 2021 and, for MGTA-145 specifically, can provide proof-of-concept for stem cell mobilization across multiple diseases and the first clinical data for MGTA-117 targeted conditioning, said Jason Gardner, D. Phil., President and Chief Executive Officer, Magenta. I am also delighted to welcome Alison Lawtons return to Magentas Board of Directors. Alison brings extensive experience and leadership in both regulatory and business arenas, essential as the Magenta portfolio advances. We look forward to building on the momentum generated in 2020 as we relentlessly focus on execution.

Stem Cell Mobilization and Collection

MGTA-145: Three Phase 2 Clinical Trials Ongoing or Planned

Autologous Stem Cell Transplant of Multiple Myeloma Patients. Previously announced ongoing enrollment continues for the Phase 2 investigator-initiated clinical trial of MGTA-145, used in combination with plerixafor, to mobilize and collect stem cells for autologous stem cell transplantation in multiple myeloma patients at Stanford University. Magenta expects that this trial will provide data on stem cell mobilization and collection, durability of engraftment in transplanted patients and disease outcomes, including progression-free survival. Initial data from the study are expected in mid-2021.

Allogeneic Donor Stem Cell Mobilization and Collection for Stem Cell Transplant in AML, ALL and MDS Patients. Through a collaboration with the National Marrow Donor Program/Be The Match, Magenta plans to initiate, within the next several weeks, a Phase 2 clinical trial using MGTA-145 to mobilize and collect stem cells from allogeneic donors for transplant in patients with AML, ALL and MDS. This clinical trial will evaluate stem cell mobilization, collection, cell quality, engraftment and disease outcomes, including Graft-versus-Host Disease (GvHD), which is of particular importance in the allogeneic transplant setting. Initial data from this clinical trial are expected in the second half of 2021.

Sickle Cell Disease Stem Cell Mobilization and Collection; Cell Characterization; Pre-Clinical Gene Modification Model. In collaboration with bluebird bio, Magenta plans to initiate a Phase 2 clinical trial in the second half of 2021 to evaluate MGTA-145, in combination with plerixafor, for the mobilization and collection of stem cells in adults and adolescents with sickle cell disease (SCD). Each party will characterize the cells and Magenta plans to gene-correct the cells and transplant them into established pre-clinical disease models to evaluate engraftment. Data from this clinical trial could provide proof-of-concept for MGTA-145, in combination with plerixafor, as the preferred mobilization regimen for patients with SCD and, more broadly, across all gene therapy applications where safe, reliable and rapid mobilization of quality stem cells for gene-modification and transplant are necessary components.

About MGTA-145

Magenta is developing MGTA-145 in combination with plerixafor to harness complementary mechanisms to mobilize hematopoietic stem cells (HSCs) for collection and transplantation. This combination has the potential to be the preferred mobilization regimen for safe, rapid and reliable mobilization and collection of HSCs and could improve outcomes in autologous and allogeneic stem cell transplantation.

Targeted Conditioning

MGTA-117: Plans to Initiate Phase 1 Clinical Trial in mid-2021; Initial Safety and Pharmacokinetics (PK) data to be assessed in the fourth quarter of 2021

AML and MDS. Magenta is completing its IND-enabling GLP toxicology studies and GMP manufacturing process for MGTA-117, the first antibody-drug conjugate (ADC) candidate from the companys research platform for targeted conditioning of patients prior to receiving a stem cell transplant for blood cancers or gene therapy drug products. Later this month, Magenta expects to complete its initial discussions with the U.S. Food and Drug Administration regarding the design of the first-in-human clinical trial. Magenta expects to file an Investigational New Drug (IND) application and, upon approval, plans to initiate a Phase 1 clinical trial in mid-2021 to assess the safety and PK in the first cohort of patients in the fourth quarter of 2021.

About MGTA-117

MGTA-117, Magentas most advanced conditioning program, is a CD117-targeted antibody engineered for the transplant setting and conjugated to amanitin, a payload in-licensed from Heidelberg Pharma. MGTA-117 is designed to precisely deplete only hematopoietic stem and progenitor cells to clear space in the bone marrow prior to transplant, which supports long-term engraftment and disease outcomes in patients. MGTA-117 has shown high selectivity, potent efficacy, wide safety margins and broad tolerability in non-human primate models.

Cash Guidance

With focused allocation of resources on the Companys clinical trials and advancement of its research platform, the Company now believes its cash position will fund its operations into the first quarter of 2023.

Alison Lawton Background

Ms. Lawton is an executive leader with more than 30 years of experience in biopharma. She served as President and Chief Executive Officer of Kaleido Biosciences, Inc. (Nasdaq: KLDO) from August 2018 to June 2020, and served as President and Chief Operating Officer from December 2017 to August 2018. Prior to joining Kaleido Biosciences, Inc., Ms. Lawton served as Chief Operating Officer at Aura Biosciences, Inc., an oncology therapeutics company, from January 2015 until December 2017, and, prior to joining Aura, served as a consultant to Aura from March 2014 to December 2014. From January 2013 to January 2014, Ms. Lawton served as Chief Operating Officer at OvaScience Inc., a life sciences company. From 2014 to 2017, Ms. Lawton served as a biotech consultant for various companies, including as Chief Operating Officer consultant at X4 Pharmaceuticals. Prior to that, Ms. Lawton spent more than 20 years in various positions of increasing responsibility including Senior VP and General Manager of Biosurgery and prior, Senior VP of Market Access at Genzyme Corporation, a global biopharmaceutical company, and subsequently at Sanofi S.A., also a global biopharmaceutical company, following the acquisition of Genzyme by Sanofi in 2011. Additionally, Ms. Lawton previously served two terms as the industry representative on the U.S. Food & Drug Administrations Cell & Gene Therapy Advisory Committee and as Chairman of the Board of the Regulatory Affairs Professional Society. Ms. Lawton currently serves on the boards of directors of ProQR Therapeutics N.V., X4 Pharmaceuticals Inc. and Aeglea Biotherapeutics Inc. Ms. Lawton previously served on the boards of directors of Magenta Therapeutics, Kaleido Biosciences Inc., Verastem, Inc., CoLucid Pharmaceuticals, Inc. prior to its acquisition by Eli Lilly and Cubist Pharmaceuticals, Inc. prior to its acquisition by Merck & Co. Ms. Lawton holds a B.Sc. in pharmacology from Kings College, University of London.

Upcoming Presentations at the 2021 Transplantation and Cellular Therapy (TCT) Annual Meeting

Title: MGTA-145 / Plerixafor-Mediated HSC Mobilization and Intravenous HDAd5/35++ Vector Injection into Mice Allows for Efficient In Vivo HSC Transduction and Stable Gene Marking in Peripheral Blood Cells (Oral Abstract, #16)Presenting Author: Chang Li, Ph.D., Division of Medical Genetics, Department of Medicine, University of WashingtonDate and Time of Oral Presentation: Monday, February 8, 2021, 2:30 PM CST

Title: MGTA-145, In Combination with Plerixafor in a Phase 1 Clinical Study, Mobilizes Large Numbers of Hematopoietic Stem Cells and a Graft with Potent Immunosuppressive Properties for Autologous and Allogeneic Transplant (Oral Abstract, #35)Presenting Author: Kevin Goncalves, Ph.D., Magenta TherapeuticsDate and Time of Oral Presentation: Tuesday, February 9, 2021, 3:00 PM CST

Title: MGTA-456, A CD34 Expanded Cord Blood Product, Permits Selection of Better HLA Matched Units and Results in Rapid Hematopoietic Recovery, Uniform Engraftment and Reduced Graft-Versus-Host Disease in Adults with High-Risk Hematologic Malignancies (Oral Abstract, #31)Presenting Author: Heather Stefanski, M.D., Ph.D., Assistant Professor, Department of Pediatrics, University of MinnesotaDate and Time of Oral Presentation: Tuesday, February 9, 2021, 3:00 PM CST

Title: A Single Dose of a Novel Anti-Human CD117-Amanitin Antibody Drug Conjugate (ADC) Engineered for a Short Half-life Provides Dual Conditioning and Anti-Leukemia Activity and Extends Survival Compared to Standard of Care in Multiple Pre-clinical Models of Acute Myeloid Leukemia (AML) (Oral Abstract, #53)Presenting Author: Leanne Lanieri, M.S., Magenta TherapeuticsDate and Time of Oral Presentation: Wednesday, February 10, 2021, 3:00 PM CST

Title: Targeted CD45 Antibody Drug Conjugate Enables Full Mismatch Allogeneic Hematopoietic Stem Cell Transplantation in a Murine HSCT Model as a Single Agent (AML) (Poster #242)Lead Author: Sharon Hyzy, M.S., Magenta Therapeutics

About Magenta Therapeutics

Magenta Therapeutics is a clinical-stage biotechnology company developing medicines to bring the curative power of immune system reset through stem cell transplant to more patients with blood cancer, genetic diseases and autoimmune diseases. Magenta is combining leadership in stem cell biology and biotherapeutics development with clinical and regulatory expertise, a unique business model and broad networks in the stem cell transplant world to revolutionize immune reset for more patients.

Magenta is based in Cambridge, Mass. For more information, please visit http://www.magentatx.com.

Follow Magenta on Twitter: @magentatx.

Forward-Looking Statement

This press release may contain forward-looking statements and information within the meaning of The Private Securities Litigation Reform Act of 1995 and other federal securities laws, including express or implied statements regarding Magentas future expectations, plans and prospects, including, without limitation, statements regarding expectations and plans for presenting clinical data, projections regarding our long-term growth, cash, cash equivalents and marketable securities, the anticipated timing of our clinical trials and regulatory filings, the development of our product candidates and advancement of our clinical programs, the timing, progress and success of our collaborations, as well as other statements containing words such as may, will, could, should, expects, intends, plans, anticipates, believes, estimates, predicts, projects, seeks, endeavor, potential, continue or the negative of such words or other similar expressions that can be used to identify forward-looking statements. The express or implied forward-looking statements included in this press release are only predictions and are subject to a number of risks, uncertainties and assumptions, including, without limitation: uncertainties inherent in clinical studies and in the availability and timing of data from ongoing clinical studies; whether interim results from a clinical trial will be predictive of the final results of the trial; whether results from pre-clinical studies or earlier clinical studies will be predictive of the results of future trials; the expected timing of submissions for regulatory approval or review by governmental authorities; regulatory approvals to conduct trials or to market products; whether Magenta's cash resources will be sufficient to fund Magenta's foreseeable and unforeseeable operating expenses and capital expenditure requirements; risks, assumptions and uncertainties regarding the impact of the continuing COVID-19 pandemic on Magentas business, operations, strategy, goals and anticipated timelines, Magentas ongoing and planned pre-clinical activities, Magentas ability to initiate, enroll, conduct or complete ongoing and planned clinical trials, Magentas timelines for regulatory submissions and Magentas financial position; and other risks concerning Magenta's programs and operations set forth under the caption Risk Factors in Magentas Annual Report on Form 10-K filed on March 3, 2020, as updated by Magentas most recent Quarterly Report on Form 10-Q and its other filings with the Securities and Exchange Commission. In light of these risks, uncertainties and assumptions, the forward-looking events and circumstances discussed in this press release may not occur and actual results could differ materially and adversely from those anticipated or implied in the forward-looking statements. You should not rely upon forward-looking statements as predictions of future events. Although Magenta believes that the expectations reflected in the forward-looking statements are reasonable, it cannot guarantee that the future results, levels of activity, performance or events and circumstances reflected in the forward-looking statements will be achieved or occur. Moreover, except as required by law, neither Magenta nor any other person assumes responsibility for the accuracy and completeness of the forward-looking statements included in this press release. Any forward-looking statement included in this press release speaks only as of the date on which it was made. We undertake no obligation to publicly update or revise any forward-looking statement, whether as a result of new information, future events or otherwise, except as required by law.

Magenta Therapeutics:Lyndsey Scull, Director, Corporate Communications, Magenta Therapeutics202-213-7086lscull@magentatx.com

Investor inquiries:Jill Bertotti, W2O Group714-225-6726jbertotti@w2ogroup.com

Media inquiries:Dan Budwick1ABdan@1abmedia.com

Read more from the original source:
Magenta Therapeutics Highlights Recent Progress and Expected Timing of 2021 Milestones, Including Fo - PharmiWeb.com

SACRAMENTO, Calif., Jan. 12, 2021 /PRNewswire/ --The Sacramento Metropolitan Chamber of Commerce announced it will name Cate Dyer, CEO of StemExpress, the "Businesswoman of the Year" at their 126th Annual Business Awards. Since 1895, Metro Chamber has recognized Sacramento's most esteemed players in the business community. The 2021 Annual Dinner and Business Awards will be held virtually for the first time, and Ms. Dyer will receive this extraordinary honor on February 5th, 2021.

Ms. Dyer founded StemExpress in 2010 to accelerate the cure and prevention of significant medical conditions at life-changing speed. StemExpress supports medical research, clinical trials, commercialization of disease specific treatment, cell and gene therapies, precision and regenerative medicine, as well as researchers and clinicians from all around the world who are developing new treatments and cures. StemExpress has a network of healthcare partnerships that includes over 50 hospitals in Europe as well as three (3) US healthcare systems that encompasses 31 hospitals, 35 outpatient facilities and 20 individual practices. StemExpress is currently the nation's leading biospecimen provider of human primary cells, stem cells, human bone marrow, cord blood, peripheral blood, maternal blood, and disease-state products for academic, biotechnological, diagnostic, pharmaceutical and contract research organizations. StemExpress is registered with the U.S. Food and Drug Administration (FDA) and has seven (7) independently owned and operated brick-and mortar cellular clinics across the United States to collect blood, cells and tissue from patients and donors. These clinics include state-of-the-art cell manufacturing laboratories for clinical and research purposes, and CLIA certified/high-complexity diagnostics.

Since inception, StemExpress has been committed to transformative, positive impacts on the community. In line with this commitment, StemExpress immediately recognized the unparalleled challenges the COVID-19 virus presented to its communities, healthcare entities, local businesses, and the economy at large. In a matter of weeks, the company built out a seamless, end-to-end COVID-19 testing solution, all while continuing to grow its core cellular business. This end-to-end solution includes on-line patient registration, scheduling, specimen collection, pop-up site management, and laboratory testing using gold-standard PCR testing at high-volume capacity with rapid turn-around times. StemExpress directly and proudly supports frontline workers, inner city communities, hospitals, skilled nursing facilities, school districts, correctional facilities, utility companies, major league sports, tribal territories and territorial governments, among others. Through public health partnerships, StemExpress has also provided free testing services to vulnerable members of the community, including the uninsured and other under-represented populations.

The 2021 Annual Business Awards will pay tribute to Cate Dyer's extraordinary effort to support Sacramento's communities, businesses, and the heroes who keep our economy moving.

Contact: [emailprotected]

SOURCE StemExpress

https://www.stemexpress.com

Continued here:
Cate Dyer of StemExpress is Named Businesswoman of the Year! - PRNewswire

Abstract

Terminally differentiated murine osteocytes and adipocytes can be reprogrammed using platelet-derived growth factorAB and 5-azacytidine into multipotent stem cells with stromal cell characteristics. We have now optimized culture conditions to reprogram human adipocytes into induced multipotent stem (iMS) cells and characterized their molecular and functional properties. Although the basal transcriptomes of adipocyte-derived iMS cells and adipose tissuederived mesenchymal stem cells were similar, there were changes in histone modifications and CpG methylation at cis-regulatory regions consistent with an epigenetic landscape that was primed for tissue development and differentiation. In a non-specific tissue injury xenograft model, iMS cells contributed directly to muscle, bone, cartilage, and blood vessels, with no evidence of teratogenic potential. In a cardiotoxin muscle injury model, iMS cells contributed specifically to satellite cells and myofibers without ectopic tissue formation. Together, human adipocytederived iMS cells regenerate tissues in a context-dependent manner without ectopic or neoplastic growth.

The goal of regenerative medicine is to restore function by reconstituting dysfunctional tissues. Most tissues have a reservoir of tissue-resident stem cells with restricted cell fates suited to the regeneration of the tissue in which they reside (14). The innate regenerative capacity of a tissue is broadly related to the basal rate of tissue turnover, the health of resident stem cells, and the hostility of the local environment. Bone marrow transplants and tissue grafts are frequently used in clinical practice but for most tissues, harvesting and expanding stem and progenitor cells are currently not a viable option (5, 6). Given these constraints, research efforts have been focused on converting terminally differentiated cells into pluripotent or lineage-restricted stem cells (7, 8). However, tissues are often a complex mix of diverse cell types that are derived from distinct stem cells. Therefore, multipotent stem cells may have advantages over tissue-specific stem cells. To be of use in regenerative medicine, these cells would need to respond appropriately to regional cues and participate in context-dependent tissue regeneration without forming ectopic tissues or teratomas. Mesenchymal stem cells (MSCs) were thought to have some of these characteristics (911), but despite numerous ongoing clinical trials, evidence for their direct contribution to new tissue formation in humans is sparse, either due to the lack of sufficient means to trace cell fate in hosts in vivo or failure of these cells to regenerate tissues (12, 13).

We previously reported a method by which primary terminally differentiated somatic cells could be converted into multipotent stem cells, which we termed as induced multipotent stem (iMS) cells (14). These cells were generated by transiently culturing primary mouse osteocytes in medium supplemented with azacitidine (AZA; 2 days) and platelet-derived growth factorAB (PDGF-AB; 8 days). Although the precise mechanisms by which these agents promoted cell conversion was unclear, the net effect was reduced DNA methylation at the OCT4 promoter and reexpression of pluripotency factors (OCT4, KLF4, SOX2, c-MYC, SSEA-1, and NANOG) in 2 to 4% of treated osteocytes. iMS cells resembled MSCs with comparable morphology, cell surface phenotype, colony-forming unit fibroblast (CFU-F), long-term growth, clonogenicity, and multilineage in vitro differentiation potential. iMS cells also contributed directly to in vivo tissue regeneration and did so in a context-dependent manner without forming teratomas. In proof-of-principle experiments, we also showed that primary mouse and human adipocytes could be converted into long-term repopulating CFU-Fs by this method using a suitably modified protocol (14).

AZA, one of the agents used in this protocol, is a cytidine nucleoside analog and a DNA hypomethylating agent that is routinely used in clinical practice for patients with higher-risk myelodysplastic syndrome (MDS) and for elderly patients with acute myeloid leukemia (AML) who are intolerant to intensive chemotherapy (15, 16). AZA is incorporated primarily into RNA, disrupting transcription and protein synthesis. However, 10 to 35% of drug is incorporated into DNA resulting in the entrapment and depletion of DNA methyltransferases and suppression of DNA methylation (17). Although the relationship between DNA hypomethylation and therapeutic efficacy in MDS/AML is unclear, AZA is known to induce an interferon response and apoptosis in proliferating cells (1820). PDGF-AB, the other critical reprogramming agent, is one of five PDGF isoforms (PDGF-AA, PDGF-AB, PDGF-BB, PDGF-CC, and PDGF-DD), which bind to one of two PDGF receptors (PDGFR and PDGFR) (21). PDGF isoforms are potent mitogens for mesenchymal cells, and recombinant human (rh)PDGF-BB is used as an osteoinductive agent in the clinic (22). PDGF-AB binds preferentially to PDGFR and induces PDGFR- homodimers or PDGFR- heterodimers. These are activated by autophosphorylation to create docking sites for a variety of downstream signaling molecules (23). Although we have previously demonstrated induction of CFU-Fs from human adipocytes using PDGF-AB/AZA (14), the molecular changes, which underlie conversion, and the multilineage differentiation potential and in vivo regenerative capacity of the converted cells have not been determined.

Here, we report an optimized PDGF-AB/AZA treatment protocol that was used to convert primary human adipocytes, a tissue source that is easily accessible and requires minimal manipulation, from adult donors aged 27 to 66 years into iMS cells with long-term repopulating capacity and multilineage differentiation potential. We also report the molecular landscape of these human iMS cells along with that of MSCs derived from matched adipose tissues and the comparative in vivo regenerative and teratogenic potential of these cells in mouse xenograft models.

Primary mature human adipocytes were harvested from subcutaneous fat (Fig. 1A and table S1) and their purity confirmed by flow cytometry with specific attention to the absence of contaminating adipose-derived MSCs (AdMSCs) (fig. S1, A and B). As previously described (14), plastic adherent adipocytes were cultured in Alpha Minimum Essential Medium (MEM) containing rhPDGF-AB (200 ng/ml) and 20% autologous serum (AS) with and without 10 M AZA for 2 and 23 days, respectively (Fig. 1A). During daily observations, unilocular lipid globules were observed to fragment within adipocytes ~day 10 with progressive extrusion of fat into culture medium, coincident with changes in cell morphology (movie S1). Consistent with these observations, when fixed and stained with Oil Red O, adipocytes that were globular in shape at the start of culture resembled lipid laden stromal cells at day 12 and lipid-free stromal cells at day 25 (Fig. 1B).

(A) Generation and reprogramming of adipocytes. (B) Oil Red Ostained adipocytes (days 0, 12, and 25) during treatment with recombinant human platelet-derived growth factorAB (rhPDGF-AB) and AZA. (C) Flow cytometry plots of LipidTOX and PDGFR in adipocytes cultured as in (A). (D) CFU-F counts from treated and untreated adipocytes during conversion. (E) CFU-F counts from adipocytes treated (Rx) with indicated combinations of rhPDGF-AB, AZA, fetal calf serum (FCS), autologous serum (AS), or serum-free media (SFM). (F) CFU-F counts from adipocytes reprogrammed in the presence of 0, 1, or 10 M PDGFR/ inhibitor AG1296. (G) CFU-F counts per 400 reprogrammed adipocytes from three donor age groups (n = 3 for each) generated using indicated combinations of rhPDGF-AB and AZA. (H) Long-term growth of reprogrammed adipocytes from three donor age groups (n = 3 for each) generated using indicated combinations of rhPDGF-AB and AZA. (I) Long-term growth of iMS cells cultured in SFM or media supplemented with FCS, autologous, or allogeneic serum. Error bars indicate SD, n = 3; *P < 0.05, **P < 0.01, and ***P < 0.0001 calculated using either a Students t test (E and F) or a linear mixed model (H). Photo credit: Avani Yeola, UNSW Sydney.

To evaluate these changes in individual cells, we performed flow cytometry at multiple time points during treatment and probed for adipocyte (LipidTOX) (24) and stromal cell characteristics [PDGFR expression (25); Fig. 1C]. A subpopulation of adipocytes, when cultured in media supplemented with PDGF-AB/AZA and AS (Fig. 1C, top; treated), showed reduced LipidTOX staining intensity at day 10, with progressive reduction and complete absence in all cells by day 19. Adipocytes cultured in the absence of PDGF-AB/AZA retained LipidTOX staining, albeit with reduced intensity (Fig. 1C, bottom; untreated). Adipocytes expressed PDGFR [fig. S1C, (i) and (ii)] but not PDGFR (Fig. 1C) at day 0 but both the frequency and intensity of PDGFR staining increased from day 21. To record these changes in real time, we also continuously live-imaged treated adipocytes from days 15 to 25 and recorded the extrusion of fat globules, change in cell morphology from globular to stromal, and acquisition of cell motility and cell mitosis (movie S1 and fig. S1D). Intracellular fragmentation of fat globules was observed over time in untreated adipocytes (fig. S1E), consistent with variable LipidTOX staining intensity. CFU-F capacity was absent at day 10, present in day 15 cultures, and tripled by day 19 with no substantial increase at days 21, 23, and 25 (Fig. 1D). It is noteworthy that CFU-F potential was acquired before PDGFRA surface expression when adipocytes had started to display stromal cell morphology and had diminished fat content. There was also no CFU-F capacity in adipocytes cultured in MEM with fetal calf serum (FCS) or AS, unless supplemented with both PDGF-AB and AZA. CFU-F capacity was significantly higher with AS than with FCS and absent in serum-free media (SFM) (Fig. 1E and fig. S1F). As previously shown with reprogramming of murine osteocytes, there was dose-dependent inhibition of CFU-F capacity when AG1296, a potent nonselective PDGF receptor tyrosine kinase inhibitor (26), was added to the reprogramming media (Fig. 1F).

To evaluate the impact of patient age and concentrations of PDGF-AB and AZA on the efficiency of human adipocyte conversion, we harvested subcutaneous fat from donors aged 40 (n = 3), 41 to 60 (n = 3), and 61 (n = 3) years and subjected each to three different concentrations of PDGF-AB (100, 200, and 400 ng/ml) and three different concentrations of AZA (5, 10, and 20 M) (Fig. 1G). Although all combinations supported cell conversion in all donors across the three age groups, rhPDGF-AB (400 ng/ml) and 5 M AZA yielded the highest number of CFU-Fs (Fig. 1G). When these cultures were serially passaged in SFM (with no PDGF-AB/AZA supplementation, which was used for cell conversion only), adipocytes converted with reprogramming media containing rhPDGF-AB (400 ng/ml) and 5 M AZA were sustained the longest (Fig. 1H, fig. S2A, and table S2). The growth plateau that was observed even with these cultures [i.e., adipocytes converted with rhPDGF-AB (400 ng/ml) and 5 M AZA when expanded in SFM or FCS] was overcome when cells were expanded in either autologous or allogeneic human serum (Fig. 1I). The genetic stability of human iMS cells (RM0072 and RM0073) was also assessed using single-nucleotide polymorphism arrays and shown to have a normal copy number profile at a resolution of 250 kb (fig. S2B). Together, these data identify an optimized protocol for converting human primary adipocytes from donors across different age groups and show that these can be maintained long term in culture.

Given the stromal characteristics observed in human adipocytes treated with PDGF-AB/AZA (Fig. 1), we performed flow cytometry to evaluate their expression of MSC markers CD73, CD90, CD105, and STRO1 (13) and noted expression levels comparable to AdMSCs extracted from the same subcutaneous fat harvest (Fig. 2A). Primary untreated adipocytes (day 25 in culture) did not express any of these MSC markers (fig. S3A). The global transcriptomes of iMS cells and matched AdMSCs were distinct from untreated control adipocytes but were broadly related to each other [Fig. 2B, (i) and (ii)]. Ingenuity pathway analysis (IPA) using genes that were differentially expressed between AdMSCs versus adipocytes [3307 UP/4351 DOWN in AdMSCs versus adipocytes; false discovery rate (FDR) 0.05] and iMS versus adipocytes (3311 UP/4400 DOWN in iMS versus adipocytes; FDR 0.05) showed changes associated with gene expression, posttranslational modification, and cell survival pathways and organismal survival and systems development [Fig. 2B(iii)]. The number of differentially expressed genes between iMS cells and AdMSCs was limited (2 UP/26 DOWN in iMS versus AdMSCs; FDR 0.05) and too few for confident IPA annotation. All differentially expressed genes and IPA annotations are shown in table S3 (A to E, respectively).

(A) Flow cytometry for stromal markers on AdMSCs (green) and iMS cells (purple) from matched donors. Gray, unstained controls. (B) (i) Principal components analysis (PCA) plot of adipocyte, AdMSC, and iMS transcriptomes. (ii) Hierarchical clustering of differentially expressed genes (DEGs, FDR 0.05). (iii) Ingenuity pathway analysis (IPA) of DEG between AdMSCs/adipocytes (top) or iMS cells/adipocytes (bottom). The most enriched annotated biological functions are shown. (C) (i) Chromatin immunoprecipitation sequencing (ChIP-seq) profiles in AdMSCs and iMS cells from matched donors at a representative locus. Gray bar indicates differential enrichment. (ii) Volcano plots of H3K4me3, H3K27Ac, and H3K27me3 enrichment peaks significantly UP (red) or DOWN (blue) in iMS cells versus AdMSCs. (iii) IPA of corresponding genes. log2FC, log2 fold change. (D) (i) DNA methylation at a representative locus in AdMSCs and iMS cells from matched donors. (ii) Volcano plot of regions with significantly higher (red) or lower (blue) DNA methylation in iMS cells versus AdMSCs. (iii) IPA using genes corresponding to differentially methylated regions (DMRs). (E) OCT4, NANOG, and SOX2 expression in iPS, AdMSCs, and iMS cells. Percentage of cells expressing each protein is indicated. DAPI, 4,6-diamidino-2-phenylindole. (F) AdMSCs and iMS cells differentiated in vitro. Bar graphs quantify staining frequencies, error bars show SD, n = 3. ***P < 0.001 (Students t test). Photo credit: Avani Yeola, UNSW Sydney.

In the absence of significant basal differences in the transcriptomes of AdMSCs and iMS cells, and the use of a hypomethylating agent to induce adipocyte conversion into iMS cells, we examined global enrichment profiles of histone marks associated with transcriptionally active (H3K4me3 and H3K27Ac) and inactive (H3K27me3) chromatin. There were differences in enrichment of specific histone marks in matched AdMSCs versus iMS cells at gene promoters and distal regulatory regions [Fig. 2C(i) and fig. S3, B to D]. H3K4me3, H3K27ac, and H3K27me3 enrichments were significantly higher at 255, 107, and 549 regions and significantly lower at 222, 78, and 98 regions in iMS cells versus AdMSCs [Fig. 2C(ii) and table S4, A to C] and were assigned to 237, 84, and 350 and 191, 58, and 67 genes, respectively. IPA was performed using these gene lists to identify biological functions that may be primed in iMS cells relative to AdMSCs [Fig. 2C(iii) and table S4, D to F]. Among these biological functions, annotations for molecular and cellular function (cellular movement, development, growth, and proliferation) and systems development (general; embryonic and tissue development and specific; cardiovascular, skeletal and muscular, and hematological) featured strongly and overlapped across the different epigenetic marks.

We extended these analyses to also assess global CpG methylation in matched AdMSCs and iMS cells using reduced representation bisulfite sequencing [RRBS; (27)]. Again, there were loci with differentially methylated regions (DMRs) in iMS cells versus AdMSCs [Fig. 2D(i)] with increased methylation at 158 and reduced methylation at 397 regions among all regions assessed [Fig. 2D(ii) and table S4G]. IPA of genes associated with these DMRs showed a notable overlap in annotated biological functions [Fig. 2D(iii) and table S4H] with those associated with differential H3K4me3, H3K27Ac, and H3K27me3 enrichment [Fig. 2C(iii) and table S4, E to G]. Together, these data imply that although basal transcriptomic differences between iMS cells and AdMSCs were limited, there were notable differences in epigenetic profiles at cis-regulatory regions of genes that were associated with cellular growth and systems development.

We next compared iMS cells to adipocytes from which they were derived. Expression of genes associated with adipogenesis was depleted in iMS cells (fig. S4A and table S4I). The promoter regions of these genes in iMS cells had broadly retained an active histone mark (H3K4me3), but, in contrast with adipocytes, many had acquired an inactive mark (H3K27me3) (fig. S4B and table S4J). However, there were examples where iMS cells had lost active histone marks (H3K4me3 and H3K27ac) at gene promoters and potential regulatory regions and gained repressive H3K27me3 [e.g., ADIPOQ; fig. S4C(i)]. In contrast, stromal genes had acquired active histone marks and lost repressive H3K27me3 [e.g. EPH2A; fig. S4C(ii)]. It is noteworthy that promoter regions of genes associated with muscle and pericytes (table S4K) were enriched for active histone marks in iMS cells compared with adipocytes [fig. S4D, (i) and (ii)]. We also compared demethylated CpGs in iMS cells and adipocytes (fig. S4E). There were 7366 sites in 2971 genes that were hypomethylated in iMS cells, of which 236 showed increased expression and were enriched for genes associated with tissue development and cellular growth and proliferation (fig. S4E).

PDGF-AB/AZAtreated murine osteocytes (murine iMS cells), but not bone-derived MSCs, expressed pluripotency associated genes, which were detectable by immunohistochemistry in 1 to 4% of cells (14). To evaluate expression in reprogrammed human cells, PDGF-AB/AZAtreated human adipocytes and matched AdMSCs were stained for OCT4, NANOG, and SOX2 with expression noted in 2, 0.5, and 3.5% of iMS cells respectively, but no expression was detected in AdMSCs (Fig. 2E). In addition to these transcription factors, we also evaluated surface expression of TRA-1-60 and SSEA4. Both proteins were uniformly expressed on iPSCs and absent in AdMSCs [fig. S4F(i)] and adipocytes [fig. S4F(ii)]. Although TRA-1-60 was absent in iMS cells, most (78%) expressed SSEA4 but rarely (<1%) coexpressed OCT4 and NANOG [fig. S4F(i)].

MSCs can be induced to differentiate in vitro into various cell lineages in response to specific cytokines and culture conditions. To evaluate the in vitro plasticity of human iMS cells, we induced their differentiation along with matched AdMSCs and primary adipocytes, into bone, fat, and cartilage, as well as into other mesodermal Matrigel tube-forming assays for endothelial cells (CD31) and pericytes (PDGFR) and muscle (MYH, myosin heavy chain; SMA, smooth muscle actin), endodermal (hepatocyte; HNF4, hepatocyte nuclear factor ), and neuroectodermal (TUJ1; neuron specific class III beta tubulin) lineages (Fig. 2F and fig. S4G). Whereas primary adipocytes remained as such and were resistant to transdifferentiation, iMS cells and AdMSCs showed comparable differentiation potential with the notable exception that only iMS cells generated pericyte-lined endothelial tubes in Matrigel. In keeping with these findings, relative to AdMSCs, iMS cells showed permissive epigenetic marks at pericyte genes [increased H3K4me3 and H3K27Ac; EPHA2 and MCAM; fig. S4H(i); and reduced CpG methylation; NOTCH1, SMAD7, TIMP2, AKT1, and VWF; fig. S4H(ii)]. Together with the notable differences in epigenetic profiles, these functional differences and low-level expression of pluripotency genes in iMS cell subsets suggested that these cells could be more amenable than matched AdMSCs to respond to developmental cues in vivo.

To evaluate spontaneous teratoma formation and in vivo plasticity of iMS cells, we tagged these cells and their matched AdMSCs with a dual lentiviral reporter, LeGO-iG2-Luc2 (28), that expresses both green fluorescent protein (GFP) and luciferase under the control of the cytomegalovirus promoter (Fig. 3A). To test teratoma-initiating capacity, we implanted tagged cells under the right kidney capsules of NOD Scid Gamma (NSG) mice (n = 3 per treatment group) after confirming luciferase/GFP expression in cells in culture (fig. S5, A and B). Weekly bioluminescence imaging (BLI) confirmed retention of cells in situ [Fig. 3B(i)] with progressive reduction in signal over time [Fig. 3B(ii)] and the absence of teratomas in kidneys injected with either AdMSCs or iMS cells [Fig. 3B(iii)]. Injection of equivalent numbers of iPS cells and iPS + iMS cell mixtures (1:49) to approximate iMS fraction expressing pluripotency markers led to spontaneous tumor formation in the same timeframe [Fig. 3B(iii)].

(A) Generation of luciferase/GFP-reporter AdMSCs and iMS cells, and assessment of their in vivo function. (B) Assessment of teratoma initiating capacity; (i) bioluminescence images at 0, 2, 6, and 8 weeks after implantation of 1 106 matched AdMSCs and iMS cells (P2; RM0057; n = 2 per group) under the right kidney capsules. (ii) Quantification of bioluminescence. (iii) Gross kidney morphology 8 weeks following subcapsular implantation of cells (R) or vehicle control (L). (C) Assessment of in vivo plasticity in a posterior-lateral intertransverse lumbar fusion model; (i) bioluminescence images following lumbar implantation of 1 106 matched AdMSCs or iMS cells (P2; RM0038; n = 3 per group) at 1 and 365 days after transplant. (ii) Quantification of bioluminescence. (iii) Tissues (bone, cartilage, muscle, and blood vessels) harvested at 6 months after implantation stained with (left) hematoxylin and eosin or (right) lineage-specific anti-human antibodies circles/arrows indicate regions covering GFP and lineage markerpositive cells. Corresponding graphs show donor cell (GFP+) contributions to bone, cartilage, muscle, and blood vessels as a fraction of total (DAPI+) cells in four to five serial tissue sections. Bars indicate confidence interval, n = 3. Photo Credit: Avani Yeola, UNSW Sydney.

To evaluate whether iMS cells survived and integrated with damaged tissues in vivo, we implanted transduced human iMS cells and matched AdMSCs controls into a posterior-lateral intertransverse lumbar fusion mouse model (Fig. 3A) (29). Cells were loaded into Helistat collagen sponges 24 hours before implantation into the posterior-lateral gutters adjacent to decorticated lumbar vertebrae of NSG mice (n = 9 iMS and n = 9 AdMSC). Cell retention in situ was confirmed by intraperitoneal injection of d-luciferin (150 mg/ml) followed by BLI 24 hours after cell implantation, then weekly for the first 6 weeks and monthly up to 12 months from implantation [Fig. 3C(i)]. The BLI signal gradually decreased with time but persisted at the site of implantation at 12 months, the final assessment time point [Fig. 3C(ii)]. Groups of mice (n = 3 iMS and n = 3 AdMSC) were euthanized at 3, 6, and 12 months and tissues harvested from sites of cell implantation for histology and immunohistochemistry [Fig. 3C(iii)]. Although implanted iMS cells and AdMSCs were present and viable at sites of implantation at 3 months, there was no evidence of lineage-specific gene expression in donor human cells (fig. S5C). By contrast, at 6 months after implantation, GFP+ donor iMS cells and AdMSCs were shown to contribute to new bone (BMP2), cartilage (SOX9), muscle (MYH), and endothelium (CD31) at these sites of tissue injury [Fig. 3C(iii)]. The proportion of donor cells expressing lineage-specific markers in a corresponding tissue section was significantly higher in iMS cells compared with matched AdMSCs at 6 months [Fig. 3C(iii) and table S2] as well as 12 months (fig. S5, E and D, and table S2). There was no evidence of malignant growth in any of the tissue sections or evidence of circulating implanted GFP+ iMS cells or AdMSCs (fig. S5E). Together, these data show that implanted iMS cells were not teratogenic, were retained long term at sites of implantation, and contributed to regenerating tissues in a context-dependent manner with greater efficiency than matched AdMSCs.

Although appropriate to assess in vivo plasticity and teratogenicity of implanted cells, the posterior-lateral intertransverse lumber fusion mouse model is not suited to address the question of tissue-specific differentiation and repair in vivo. To this end, we used a muscle injury model (30) where necrosis was induced by injecting 10 M cardiotoxin (CTX) into the left tibialis anterior (TA) muscle of 3-month-old female severe combined immunodeficient (SCID)/Beige mice. CTX is a myonecrotic agent that spares muscle satellite cells and is amenable to the study of skeletal muscle regeneration. At 24 hours after injury, Matrigel mixed with either 1 106 iMS cells or matched AdMSCs (or no cells as a control) was injected into the damaged TA muscle. The left (injured) and right (uninjured control) TA muscles were harvested at 1, 2, or 4 weeks after injury to assess the ability of donor cells to survive and contribute to muscle regeneration without ectopic tissue formation (Fig. 4A; cohort A). Donor human iMS cells or AdMSCs compete with resident murine muscle satellite cells to regenerate muscle, and their regenerative capacity is expected to be handicapped not only by the species barrier but also by having to undergo muscle satellite cell commitment before productive myogenesis. Recognizing this, a cohort of mice was subject to a second CTX injection, 4 weeks from the first injury/cell implantation followed by TA muscle harvest 4 weeks later (Fig. 4A; cohort B).

(A) Generation of iMS and AdMSCs and their assessment in TA muscle injury model. (B) (i) Confocal images of TA muscle stained for human CD56+ satellite cells (red) and laminin basement membrane protein (green; mouse/human). Graph shows donor hCD56+ satellite cell fraction for each treatment group. (ii) Confocal images of TA muscle harvested at 4 weeks and stained for human spectrin (red) and laminin (green; mouse/human). For each treatment, the left panel shows a tile scan of the TA muscle and the right panel a high magnification confocal image. Graph shows contribution of mouse (M), human (H), or chimeric (C) myofibers in three to five serial TA muscle sections per mouse (n = 3 mice per treatment group). (C) Confocal images of TA muscle 4 weeks following re-injury with CTX, stained for human spectrin (red) and laminin (green; mouse/human). For each treatment, left panel shows a tile scan of the TA muscle, upper right panel a low-magnification image, and lower right panel a high magnification image of the area boxed above. Graph shows contribution of mouse (M), human (H), or chimeric (C) myofibers in three to five serial TA muscle sections per mouse (n = 3 mice per treatment group). Graph bars indicate confidence interval. *P < 0.05, **P < 0.01, and ***P < 0.001 (linear mixed model). Photo credit: Avani Yeola, UNSW Sydney.

In tissue sections harvested from cohort A, donor-derived muscle satellite cells (31) [hCD56 (Thermo Fisher Scientific, MA5-11563)+; red] were evident in muscles implanted with both iMS cells and AdMSCs at each time point but were most numerous at 2 weeks after implantation [Fig. 4B(i) and fig. S6A]. The frequency of hCD56+ cells relative to total satellite cells [sublaminar 4,6-diamidino-2-phenylindolepositive (DAPI+) cells] was quantified in three to five serial sections of TA muscles per mouse in each of three mice per treatment group and was noted to be higher following the implantation of iMS cells compared with AdMSCs at all time points [week 1, 5.6% versus 2.4%; week 2, 43.3% versus 18.2%; and week 4, 30.7% versus 14.6%; Fig. 4B(i), table S2, and fig. S6A]. Donor cell contribution to regenerating muscle fibers was also assessed by measuring human spectrin (32) costaining with mouse/human laminin [(33) at 4 weeks (Fig. 4B(ii)]. At least 1000 myofibers from three to five serial sections of TA muscles for each of three mice in each treatment group were scored for human [H; hSpectrin+ (full circumference); laminin+], murine (M; mouse; hSpectrin; laminin+), or mouse/human chimeric [C; hSpectrin+ (partial circumference); laminin+] myofibers. Although none of the myofibers seen in cross section appeared to be completely human (i.e., donor-derived), both iMS cells and AdMSCs contributed to chimeric myofibers [Fig. 4B(ii)]. iMS cell implants contributed to a substantially higher proportion of chimeric fibers than AdMSC implants (57.7% versus 30.7%; table S2). In cohort B, TA muscles were allowed to regenerate following the initial CTX injection/cell implantation, and re-injured 4 weeks later with a repeat CTX injection. In these mice, although total donor cell contributions to myofibers in TA muscles harvested 4 weeks after re-injury were comparable to that observed in cohort A, there were no myofibers that appeared to be completely human (Fig. 4C). There were substantially more human myofibers following iMS cell implants than with AdMSCs (9.7% versus 5.4%; table S2). There was no evidence of ectopic tissue formation in TA muscles following implantation of either iMS cells or AdMSCs in either cohort.

To assess the physiological properties of muscles regenerated with human myofibers, we performed tetanic force contractions in extensor digitorum longus (EDL) muscles following the schema shown in Fig. 4A. Tetanic forces evoked by electrical pulses of various stimulus frequencies were not significantly different between the experimental cohorts or between the experimental cohorts and control animals [fig. S6B, (i) to (iii)]. However, when challenged with a sustained train of electrical pulses [fig. S6C(i)], the iMS group demonstrated significantly greater absolute [fig. S6C(ii)] and specific [fig. S6C(iii)] forces over a 3- to 6-s period. Together, these data showed that iMS cells had the capacity to respond appropriately to the injured environment and contribute to tissue-specific regeneration without impeding function.

We have optimized a protocol, originally designed for mouse osteocytes, to convert human primary adipocytes into iMS cells. We show that these long-term repopulating cells regenerate tissues in vivo in a context-dependent manner without generating ectopic tissues or teratomas.

PDGF-AB, AZA, and serum are indispensable ingredients in reprograming media, but the underlying reasons for their cooperativity and the observed dose-response variability between patients are not known. PDGF-AB is reported to bind and signal via PDGFR- and PDGFR- but not PDGFR- subunits (21). Mouse osteocytes and human adipocytes lack PDGFR, although surface expression was detectable as cells transition during reprogramming [mouse; day 2 of 8 (14) and human day 21 of 25]. However, these cells express PDGFR (14). Given that PDGFR inhibition attenuates iMS cell production in both mice (14) and humans, a degree of facilitated binding of PDGF-AB to PDGF- subunits or signaling through a noncanonical receptor is likely to occur, at least at the start of reprogramming. PDGF-Bcontaining homo- and heterodimers are potent mitogens that increase the pool of undifferentiated fibroblasts and preosteoblasts with rhPDGF-BB used in the clinic to promote healing of chronic ulcers and bone regeneration (34). However, the unique characteristics of PDGF-AB but not PDGF-BB or PDGF-AA that facilitate reversal and plasticity of cell identity in combination with AZA and serum (14) remain unknown.

PDGF-AB was replenished in culture throughout the reprogramming period, but AZA treatment was limited to the first 2 days for both mouse osteocyte and human adipocyte cultures. DNA replication is required for incorporation of AZA into DNA (35) and hence DNA demethylation is unlikely to be an initiating event in the conversion of terminally differentiated nonproliferating cells such as osteocytes and mature adipocytes. However, the majority of intracellular AZA is incorporated into RNA, which could directly affect the cellular transcriptome and proteome as an early event (36, 37). It is feasible that subsequent redistribution of AZA from RNA to DNA occurs when cells replicate resulting in DNA hypomethylation as a later event (38).

In the absence of serum, we could neither convert primary human adipocytes into iMS cells nor perpetuate these cells long term in culture. The efficiency of conversion and expansion was significantly higher with human versus FCS and highest with AS. The precise serum factor(s) that are required for cell conversion in conjunction with PDGF-AB and AZA are not known. The volumes of blood (~50 ml 2) and subcutaneous fat (5 g) that we harvested from donors were not limiting to generate sufficient numbers of P2 iMS cells (~10 106) for in vivo implantation and are in the range of cell numbers used in prospective clinical trials using mesenchymal precursor cells for chronic discogenic lumbar back pain (NCT02412735; 6 106) and hypoplastic left heart syndrome (NCT03079401; 20 106).

Our motivation was to optimize a protocol that could be applied to primary uncultured and easily accessible cells for downstream therapeutic applications, and adipose tissue satisfied these criteria. We have not surveyed other human cell types for their suitability for cell conversion using this protocol. It would be particularly interesting to establish whether tissue-regenerative properties of allogeneic mesenchymal precursor populations that are currently in clinical trials could be boosted by exposure to PDGF-AB/AZA. However, given that iMS cells and MSCs share stromal cell characteristics, identifying a unique set of cell surface markers that can distinguish the former is a priority that would assist in future protocol development and functional assessment of iMS cells.

Producing clinical-grade autologous cells for cell therapy is expensive and challenging requiring suitable quality control measures and certification. However, the advent of chimeric antigen receptor T cell therapy into clinical practice (39) has shown that production of a commercially viable, engineered autologous cellular product is feasible where a need exists. Although there were no apparent genotoxic events in iMS cells at P2, ex vivo expansion of cells could risk accumulation of such events and long-term follow-up of ongoing and recently concluded clinical trials using allogeneic expanded mesenchymal progenitor cells will be instructive with regard to their teratogenic potential. The biological significance of the observed expression of pluripotency-associated transcription factors in 2 to 3% of murine and human iMS cells is unknown and requires further investigation. However, their presence did not confer teratogenic potential in teratoma assays or at 12-month follow-up despite persistence of cells at the site of implantation. However, this risk cannot be completely discounted, and the clinical indications for iMS or any cell therapy require careful evaluation of need.

In regenerating muscle fibers, it was noteworthy that iMS cells appeared to follow canonical developmental pathways in generating muscle satellite cells that were retained and primed to regenerate muscle following a second muscle-specific injury. Although iMS cells were generated from adipocytes, there was no evidence of any adipose tissue generation. This supports the notion that these cells have lost their native differentiation trajectory and adopted an epigenetic state that favored response to local differentiation cues. The superior in vivo differentiation potential of iMS cells vis--vis matched AdMSCs was consistent with our data showing that despite the relatively minor transcriptomic differences between these cell types, the epigenetic state of iMS cells was better primed for systems development. Another clear distinction between iMS cells and AdMSCs was the ability of the former to produce CD31+ endothelial tube-like structures that were enveloped by PDGFR+ pericytes. An obvious therapeutic application for iMS cells in this context is vascular regeneration in the setting of critical limb ischemia to restore tissue perfusion, an area of clear unmet need (40).

An alternative to ex vivo iMS cell production and expansion is the prospect of in situ reprogramming by local subcutaneous administration of the relevant factors to directly convert subcutaneous adipocytes into iMS cells, thereby eliminating the need for ex vivo cell production. AZA is used in clinical practice and administered as a daily subcutaneous injection for up to 7 days in a 28-day cycle, with responders occasionally remaining on treatment for decades (41). Having determined the optimal dose of AZA required to convert human adipocytes into iMS cells in vitro (2 days, 5 M), the bridge to ascertaining the comparable in vivo dose would be to first measure levels of AZA incorporation in RNA/DNA following in vitro administration and match the dose of AZA to achieve comparable tissue levels in vivo. A mass spectrometrybased assay was developed to measure in vivo incorporation of AZA metabolites (AZA-MS) in RNA/DNA and is ideally suited to this application (38). The duration of AZA administration for adipocyte conversion was relatively short (i.e., 2 days), but PDGF-AB levels were maintained for 25 days. One mechanism of potentially maintaining local tissue concentrations would be to engineer growth factors to bind extra cellular matrices and be retained at the site of injection. Vascular endothelial growth factor A (VEGF-A) and PDGF-BB have recently been engineered with enhanced syndecan binding and shown to promote tissue healing (42). A comparable approach could help retain PDGF-AB at the site of injection and maintain local concentrations at the required dose. While our current data show that human adipocytederived iMS cells regenerate tissues in a context-dependent manner without ectopic or neoplastic growth, these approaches are worth considering as an alternative to an ex vivo expanded cell source in the future.

Extended methods for cell growth and differentiation assays and animal models are available in the Supplementary Materials, and antibodies used are detailed in the relevant sections.

The primary objective of this study was to optimize conditions that were free of animal products for the generation of human iMS cells from primary adipocytes and to characterize their molecular landscape and function. To this end, we harvested subcutaneous fat from donors across a broad age spectrum and used multiple dose combinations of a recombinant human growth factors and a hypomethylating agent used in the clinic and various serum types. We were particularly keen to demonstrate cell conversion and did so by live imaging and periodic flow cytometry for single-cell quantification of lipid loss and gain of stromal markers. Using our previous report generating mouse iMS cells from osteocytes and adipocytes as a reference, we first characterized the in vitro properties of human iMS cells including (i) long-term growth, (ii) colony-forming potential, (iii) in vitro differentiation, and (iv) molecular landscape. Consistent with their comparative morphology, cell surface markers, and behavioral properties, the transcriptomes (RNA sequencing) were broadly comparable between iMS cells and matched AdMSCs, leading to investigation of epigenetic differences [Assay for Transposase-Accessible Chromatin using sequencing (ATAC-seq) histone chromatin immunoprecipitation sequencing (ChIP-seq), and RRBS for DNA methylation differences] that might explain properties that were unique to iMS cells (expression of pluripotency factors, generation of endothelial tubes in vitro with pericyte envelopes, and in vivo regenerative potential). Context-dependent in vivo plasticity was assessed using a tissue injury model that was designed to promote bone/cartilage/muscle/blood vessel contributions from donor cells and simultaneously assess the absence of ectopic/malignant tissue formation by these cells (labeled and tracked in vivo using a bioluminescence/fluorescence marker). Tissue-specific regeneration and the deployment of canonical developmental pathways were assessed using a specific muscle injury model, and donor cell contributions in all injury models were performed on multiple serial tissue sections in multiple mice with robust statistical analyses (see below). Power calculations were not used, samples were not excluded, and investigators were not blinded. Experiments were repeated multiple times or assessments were performed at multiple time points. Cytogenetic and Copy Number Variation (CNV) analyses were performed on iMS and AdMSCs pretransplant, and their teratogenic potential was assessed both by specific teratoma assays and long-term implantation studies.

Subcutaneous fat and blood were harvested from patients undergoing surgery at the Prince of Wales Hospital, Sydney. Patient tissue was collected in accordance with National Health and Medical Research Council (NHMRC) National Statement on Ethical Conduct in Human Research (2007) and with approval from the South Eastern Sydney Local Health District Human Research Ethics Committee (HREC 14/119). Adipocytes were harvested as described (43). Briefly, adipose tissue was minced and digested with 0.2% collagenase type 1 (Sigma-Aldrich) at 37C for 40 min and the homogenized suspension passed through a 70-m filter, inactivated with AS, and centrifuged. Primary adipocytes from the uppermost fatty layer were cultured using the ceiling culture method (44) for 8 to 10 days. AdMSCs from the stromal vascular pellet were cultured in MEM + 20% AS + penicillin (100 g/ml) and streptomycin (250 ng/ml), and 200 mM l-glutamine (complete medium).

Adherent mature adipocytes were cultured in complete medium supplemented with AZA (R&D systems; 5, 10, and 20 M; 2 days) and rhPDGF-AB (Miltenyi Biotec; 100, 200, and 400 ng/ml; 25 days) with medium changes every 3 to 4 days. For inhibitor experiments, AG1296 was added for the duration of the culture. Live imaging was performed using an IncuCyte S3 [10 0.25numerical aperture (NA) objective] or a Nikon Eclipse Ti-E (20 0.45-NA objective). Images were captured every 30min for a period of 8 days starting from day 15. Twelve-bit images were acquired with a 1280 1024 pixel array and analyzed using ImageJ software. In vitro plasticity was determined by inducing the cells to undergo differentiation into various cell types using differentiation protocols adapted from a previous report (45).

Animals were housed and bred with approval from the Animal Care and Ethics Committee, University of New South Wales (UNSW; 17/30B, 18/122B, and 18/134B). NSG (NOD.Cg-PrkdcscidIl2rgtm1Wjl/SzJ) and SCID/Beige (C.B-Igh-1b/GbmsTac-Prkdcscid-Lystbg N, sourced from Charles River) strains were used as indicated. The IVIS Spectrum CT (Perkin Elmer) was used to capture bioluminescence. Briefly, 15 min after intraperitoneal injection of d-luciferin (150 mg/kg), images were acquired for 5 min and radiance (photon s1 cm2 sr1) was used for subsequent data analysis. The scanned images were analyzed using the Living Image 5.0 software (Perkin Elmer).

Teratoma assays (46) were performed on 3- to 4-month-old female NSG mice. Lentiviral-tagged cells (5 105) in 20 l of phosphate-buffered saline containing 80% Matrigel were injected under the right kidney capsule using a fine needle (26 gauges) and followed weekly by BLI until sacrifice at week 8. Both kidneys were collected, fixed in 4% paraformaldehyde (PFA) for 48 hours, embedded in optimal cutting temperature compound (OCT), cryosectioned, and imaged for GFP.

Posterior-lateral intervertebral disc injury model (29). Lentiviral-tagged (28) AdMSCs (1 106) or iMS cells were loaded onto Helistat collagen sponges and implanted into the postero-lateral gutters in the L4/5 lumbar spine region of anesthetized NSG mice following decortication of the transverse processes. Animals were imaged periodically for bioluminescence to track the presence of transplanted cells. At 3, 6, or 12 months, mice were euthanized, and spines from the thoracic to caudal vertebral region, including the pelvis, were removed whole. The specimens were fixed in 4% PFA for 48 hours, decalcified in 14% (w/v) EDTA, and embedded in OCT.

Muscle injury model (47). The left TA and EDL muscles of 3- to 4-month-old female SCID/Beige mice were injured by injection with 15 l of 10 M CTX (Latoxan). Confocal images of three to four serial sections (TA) per mouse were captured by Zen core/AxioVision (Carl Zeiss) and visualized by ImageJ with the colocalization and cell counter plugins [National Institutes of Health; (48)]. Tetanic force contractions were performed on EDL muscles (49).

Total RNA was extracted using the miRNeasy Mini Kit (Qiagen) according to manufacturers instructions, and 200 ng of total RNA was used for Illumina TruSeq library construction. Library construction and sequencing was performed by Novogene (HK) Co. Ltd. Raw paired-end reads were aligned to the reference genome (hg19) using STAR (https://github.com/alexdobin/STAR), and HTSeq (50) was used to quantify the transcriptomes using the reference refFlat database from the UCSC Table Browser (51). The resulting gene expression matrix was normalized and subjected to differential gene expression using DeSeq2 (52). Normalized gene expression was used to compute and plot two-dimensional principal components analysis, using the Python modules sklearn (v0.19.1; https://scikit-learn.org/stable/) and Matplotlib (v2.2.2; https://matplotlib.org/), respectively. Differentially expressed genes (log2 fold change |1|, adjusted P < 0.05) were the input to produce an unsupervised hierarchical clustering heat map in Partek Genomics Suite software (version 7.0) (Partek Inc., St. Louis, MO, USA). Raw data are available using accession GSE150720.

ChIP was performed as previously described (53) using antibodies against H3K27Ac (5 g per IP; Abcam, ab4729), H3K4Me3 (5 g per IP; Abcam ab8580), and H3K27Me3 (5 g per IP; Diagenode, C15410195). Library construction and sequencing were performed by Novogene (HK) Co. Ltd. Paired-end reads were aligned to the hg38 genome build using Burrows Wheeler Aligner (BWA) (54) duplicate reads removed using Picard (http://broadinstitute.github.io/picard/), and tracks were generated using DeepTools bamCoverage (https://deeptools.readthedocs.io/en/develop/). Peaks were called using MACS2 (55) with the parameter (P = 1 109). Differentially bound regions between the AdMSC and iMS were calculated using DiffBind (http://bioconductor.org/packages/release/bioc/vignettes/DiffBind/inst/doc/DiffBind.pdf) and regions annotated using ChIPseeker (56). Raw data are available using accession GSE151527. Adipocyte ChIP data were downloaded from Gene Expression Omnibus (GEO); accession numbers are as follows for the three histone marks: GSM916066, GSM670041, and GSM772771.

Total genomic DNA was extracted using the DNA MiniPrep Kit (Qiagen), and RRBS library construction and sequencing were performed by Novogene (HK) Co. Ltd. Raw RRBS data in fastq format were quality and adapter trimmed using trim_galore (0.6.4) with rrbs parameter (www.bioinformatics.babraham.ac.uk/projects/trim_galore). The trimmed fastq files were then aligned to a bisulfite-converted genome (Ensembl GRCh38) using Bismark (2.3.5), and methylation status at each CpG loci was extracted (57). The cytosine coverage files were converted to BigWig format for visualization. Differentially methylated cytosines (DMCs) and DMRs were identified using methylKit (1.10) and edmr (0.6.4.1) packages in R (3.6.1) (58, 59). DMCs and DMRs were annotated using ChIPseeker (56), and pathway enrichment was performed as detailed below. Raw data are available using accession number GSE151527. Adipocyte RRBS data were downloaded from GEO: GSM2342293 and GSM2342392.

IPA (Qiagen) was used to investigate enrichment in molecular and cellular functions, systems development and function, and canonical pathways.

Statistical analysis was performed in SAS. For the dose-optimization experiments (Fig. 1), a linear mixed model with participant-level random effects was used to estimate maximum time by dose level and age group. A linear mixed model with participant-level random effects was used to analyze statistical differences in lineage contribution outcomes between treatment groups (Fig. 3) and at different time points posttransplant, to estimate the percentage of cells by treatment and lineage. For the in vivo regeneration experiment (Fig. 4), a linear model was used to model the percent of cells over time for each group. Quadratic time terms were added to account for the observed increase from 1 to 2 weeks and decrease from 2 to 4 weeks. In the muscle regeneration experiment, a linear model was applied to cohort A and cohort B, to estimate and compare percent cells by treatment and source. Statistical modeling data are included in table S2.

Acknowledgments: We are indebted to the patients who donated tissue to this project. We thank E. Cook (Prince of Wales Private Hospital), B. Lee (Mark Wainwright Analytical Centre, UNSW Sydney), and technicians at the UNSW BRC Facility for assistance with sample and data collection and animal care; Y. Huang for technical assistance; and A. Unnikrishnan and C. Jolly for helpful discussions and critical reading of the manuscript. We acknowledge the facilities and scientific and technical assistance of the National Imaging Facility, a National Collaborative Research Infrastructure Strategy (NCRIS) capability, at the BRIL (UNSW). The STRO-1 antibody was a gift from S. Gronthos, University of Adelaide, Australia. Funding: We acknowledge the following funding support: A.Y. was supported by an Endeavour International Postgraduate Research scholarship from the Australian Government. S.S. is supported by an International Postgraduate Student scholarship from UNSW and the Prince of Wales Clinical School. P.S. is supported by an International Postgraduate Student scholarship from UNSW. M.L.T. and D.D.M. acknowledge funding from St. Vincents Clinic Foundation and Arrow BMT Foundation. K.A.K. acknowledges funding from Australian Research Council (FT180100417). J.M. is supported, in part, by the Olivia Lambert Foundation. M.K. is supported by a NHMRC Program Grant (APP1091261) and NHMRC Principal Research Fellowship (APP1119152). L.B.H. acknowledges funding from MTPConnect MedTech and Pharma Growth Centre (PRJ2017-55 and BMTH06) as part of the Australian Governmentfunded Industry Growth Centres Initiative Programme and The Kinghorn Foundation. D.B. is supported by a Peter Doherty Fellowship from the National Health and Medical Research Council of Australia, a Cancer Institute NSW Early Career Fellowship, the Anthony Rothe Memorial Trust, and Gilead Sciences. R.M. acknowledges funding from Jasper Medical Innovations (Sydney, Australia). J.E.P., V.C., and E.C.H. acknowledge funding from the National Health and Medical Research Council of Australia (APP1139811). Author contributions: The project was conceived by V.C. and J.E.P., and the study design and experiments were planned by A.Y., V.C., and J.E.P. Most of the experiments and data analyses were performed by A.Y., guided and supervised by V.C. and J.E.P. S.S., R.A.O., C.A.L., D.C., F.Y., M.L.T., P.S., T.H., J.R.P., P.H., W.R.W., and V.C. performed additional experiments and data analyses, with further supervision from R.M., C.P., J.A.I.T., D.C., J.W.H.W., L.B.H., D.B., and E.C.H. Statistical analyses were performed by J.O. R.M., D.D.M., J.M., K.A.K., and M.K. provided critical reagents. The manuscript was written by A.Y., J.A.I.T., V.C., and J.E.P., and reviewed and agreed to by all coauthors. Competing interests: V.C. and J.E.P. are named inventors on a patent A method of generating cells with multi-lineage potential (US 9982232, AUS 2013362880). All other authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors.

Read the rest here:
Induction of muscle-regenerative multipotent stem cells from human adipocytes by PDGF-AB and 5-azacytidine - Science Advances

This report outlines the investigative study that was conducted by a team of world renowned scientists, doctors including Hyuck Hoon KWON, Steven Hoseong YANG, Joon LEE, Byung Chul PARK, Kui Young PARK, Jae Yoon JUNG, Youin BAE,and Gyeong-Hun at Oaro Dermatology Institute (Seoul, South Korea), Guam Dermatology Institute (Guam, USA), Department of Dermatology, Dankook University, College of Medicine (Cheonan, South Korea), Department of Dermatology, Chung-Ang University, College of Medicine (Seoul, South Korea), and Department of Dermatology, Dongtan Sacred Heart Hospital, Hallym University College of Medicine (Hwaseong, South Korea). Researchers involved in this study evaluated the clinical efficacy and safety of adipose tissue stem cell-derived exosomes as an adjuvant therapy after application of fractional CO2laser for acne scars. 25 patients consisting of 18 men and 7 women, between ages 19 and 54, 12 with Fitzpatrick Skin Type 3 and 13 with Fitzpatrick skin type 4 and atrophic acne scars, underwent the 12-week prospective, double-blind, randomized, split-face trial. Each received three consecutive treatment sessions of fractional CO2laser to the whole face, with a follow-up evaluation, and a post- laser split face regimen, where one side of each patient's face was treated with an adipose tissue stem cell-derived exosome gel. Exosomes in this study were acquired from human ASC-CM by ExoSCRT technology developed by ExoCoBio Inc., and the other side of the face was treated with control gel. Findings revealed that the adipose tissue stem cell-derived exosome-treated sides of the face had achieved a significantly greater improvement than the control sides at the final follow-up visit (percentage reduction in echelle d'evaluation clinique des cicatrices d'acne scores: 32.5 vs 19.9%, p<0.01). Treatment-related erythema was milder, and post-treatment downtime was shorter on the applications of human adipose tissue stem cell-derived exosome-treated side.

The investigative study proved that a variety of applications of human adipose tissue stem cell-derived exosomes can serve as a novel cell-free therapeutic strategy in the regenerative and aesthetic medical fields and demonstrated the suitability of adipose tissue stem cell derived exosomes as an adjuvant treatment modality in combination with fractional carbon dioxide laser for the treatment of acne scars.

This reportis an open access article under the CC BY-NC license Society for Publication of Acta Dermato-Venereologica.

"The science is clearly demonstrating that exosomes are the wave of the future not just for aesthetics but for many other areas of medicine, and the richest source of this material, by far, is adipose tissue," says Dr. Randy Miller, M.D., F.A.C.S.

Facial atrophic acne scarring is a psychologically damaging condition that can cause emotional, mental, and social disability. "With a huge percentage of the world population struggling with this condition, the need for widening of therapeutic options was astoundingly clear," says Dr. Diane Duncan, M.D., F.A.C.S. who added, "While ablative fractional carbon dioxide laser resurfacing has demonstrated clinical efficacy in acne scar treatments, patients have sustained side-effects during post-procedural wound healing and had demanded improvement. The adjuvant application of adipose-derived stem cell conditioned medium with synergistic effects in augmenting treatment responses and reducing adverse effects through its potential to accelerate tissue rejuvenation is a victory for those suffering."

The sentiments have been echoed by so many other medical professionals, including, Dr. JD McCoy, NMP, whose patient roster includes professional athletes who do not have time for extended downtime and need to recover fast. "Since implementing the addition of Exosome Regenerative Complex powered by ExoSCRT into my protocol, I've observed a significant improvement in the speed of healing, skin quality and comfort during recovery," said Dr. Richard Jin, M.D., PhD. "Patients suffering from acne scarring range in all ages, and the pain that they feel is very real. Ensuring that my patients receive the best treatment results with the least amount of downtime and discomfort is non-negotiable, and that's why I choose to integrate Exosome Regenerative Complex powered by ExoSCRT, into all of my treatments."

Exosomes are lipid bilayer-enclosed extracellular vesicles, 30200 nm in diameter, produced by almost all cells and present in all body fluids (810). They are regarded as an essential mediator of intercellular communication by transferring proteins and genetic material between cells. Several studies have shown that mesenchymal stem cell-derived exosomes carry the essential properties of mesenchymal stem cells suggesting that exosomes may be a compelling alternative in regenerative and aesthetic medicine, as they would avoid most of the problems associated with live mesenchymal stem cell-based therapy. Interestingly, recent studies have shown that human adipose tissue stem cell-derived exosomes possess the critical properties of stem cells and are as potent as mesenchymal stem cells in the repair of various organ injuries.

BENEV's Exosome Regenerative Complex powered by ExoSCRT was developed and designed in tandem with the 4th largest exosome research company in the world, ExoCoBio. The intensive dual action complex is quickly absorbed into the skin, delivering the concentrated power of over 2.5 billion lyophilized exosomes, potent growth factors, peptides, co-enzymes, minerals, amino acids and vitamins. The paraben-free, steroid-free, and hypoallergenic patented technologies and ingredients are clinically proven to rejuvenate and regenerate the skin. "Lyophilizing exosomes maximize topical therapeutic potential. Making them ideal for treatments," says Dr. Richard Goldfarb, M.D., F.A.C.S.

ExoCoBio's ExoSCRT, is an innovative patented purification method of separating and refining 0.1 pure exosomes from stem cell conditioned media. The concentration of materials is significantly greater than what can be achieved with a product such as PRP. Studies have shown that this product increases fibroblast production by 180% and collagen production by 300%.

BENEV Company Inc. Medical Advisory Board Members:

Richard Jin, MD, PhD, BENEV's Chief Medical Director, studied at the Boston University School of Medicine, Harvard Medical School and the University of California Irvine. He completed research in the areas of cardiovascular disease, pulmonary hypertension, antioxidant enzyme properties, cell signaling, cellular redox mechanisms, free radical-induced oxidant stress, platelet biology, growth factors, and wound healing. For more information visitwww.rjclinicalinstitute.com

Richard M. Goldfarb, M.D, F.A.C.S., graduated from the University of Health Sciences /Finch University, The Chicago Medical School with top honors in Surgery. He completed his surgical training atNortheastern Ohio College of Medicine. He did additional training in cosmetic surgery at theUniversity of Pennsylvania, Department of Plastic Surgery andYale University. Dr. Goldfarb's 30 years of combined experience in General, Vascular, and Cosmetic Surgery provides his patients with the surgical expertise they are seeking. Dr. Goldfarb established the Center for SmartLipo & Plastic Surgery in 2007. For more information visitwww.centerforsmartlipo.com

Diane I. Duncan, M.D., F.A.C.S., obtained her medical degree from the Tulane University School of Medicine. She is certified by the American Board of Plastic Surgery and is a member of several plastic surgery professional societies, including the American Society of Plastic Surgeons (ASPS), the American Society of Aesthetic Plastic Surgeons (ASAPS) and the International Society of Aesthetic Plastic Surgeons (ISAPS). In addition to these affiliations, Dr. Duncan is a fellow of the American College of Surgeons (ACS). Dr. Duncan joined our Medical Advisory Board with over 30 years of experience in private practice as a plastic surgeon. She is an internationally recognized speaker and educator in plastic surgery and has delivered presentations at industry conferences around the world. She has also authored medical journal articles on a variety of subjects in plastic surgery and currently serves as a member of the editorial review board for theAesthetic Surgery Journal. For more information visit http://www.drdianeduncan.com

Randy B. Miller, M.D., is a board certified cosmetic and reconstructive plastic surgeon practicing in Miami, Florida. Dr. Miller earned his Bachelor of Arts in psychology and a Master's degree in clinical immunology and completed medical school at Jefferson Medical College where he graduated at the top of his class. He completed his training in general surgery and otolaryngology - head and neck surgery at Thomas Jefferson University Hospital in Philadelphia. Dr. Miller performed his plastic surgery training at Baylor College of Medicine located within the Texas Medical Center in Houston, which is the largest medical center in the world. Dr. Miller is a former president of the Miami Society of Plastic Surgeons, the Florida Society of Plastic Surgeons, and the Plastic Surgeons Patient Safety Foundation. Having served five consecutive terms on the Board of Directors of the Dade County Medical Association and as a delegate to the Florida Medical Association, Dr. Miller is a member of, and has received presidential appointments from, the American Society of Plastic Surgeons. In addition to his role as a clinical professor in the Division of Plastic Surgery at the University of Miami, Dr. Miller serves as a plastic surgery resident mentor. For many years he has served as the liaison between the University of Miami, Division of Plastic Surgery, and the Miami Society of Plastic Surgeons. Based on his research, publications and 25 years of clinical experience, Dr. Miller has become an internationally recognized expert in the fields of stem cell research and therapy, including human and veterinary tissue regeneration. Dr. Miller provides a uniquely comprehensive approach to aesthetics and age management. For more information visit http://www.millerplasticsurgery.com

Dr. J.D. McCoy, NMP, received his doctorate in Naturopathic Medicine at the Canadian College of Naturopathic Medicine. He is one of the most accomplished naturopathic physicians practicing aesthetic medicine in the country. He completed an internship in internal medicine in Hawaii, and began specialized training, certification, and externship in cosmetic medicine and light-based therapies. Dr. McCoy has devoted his specialization, passion and his entire practice to the art of less-invasive cosmetic rejuvenation, weight-management, and natural bio-identical hormone therapy since 2003. Dr. McCoy's principles in the practice of aesthetic medicine include prevention, the use of natural substances (light/energy, nutrients and other natural substances), and the use of the least invasive treatments possible. Dr. McCoy finds innovative solutions that reduce or eliminate the need for more invasive surgery- beautiful results naturally. He is recognized as an innovator and physician trainer for multiple technologies and techniques in cosmetic medicine including but most certainly not limited to a Physician Member: American Academy of Cosmetic Surgery, American Academy of Aesthetic Medicine, American Society of Aesthetic Mesotherapy, International Federation for Adipose Therapeutics and Science. For more information visitwww.contourmedical.com

BENEV Company Inc.1-949-457-2222 http://www.BENEV.com

SOURCE BENEV

http://benev.com/

Read the original:
BENEV Announces Investigative Report on Combination Treatment with Human Adipose Tissue Stem Cell- derived Exosomes and Fractional CO2 Laser for Acne...